Incidental Mutation 'R3031:Traf3ip1'
ID264714
Institutional Source Beutler Lab
Gene Symbol Traf3ip1
Ensembl Gene ENSMUSG00000034292
Gene NameTRAF3 interacting protein 1
SynonymsMIP-T3, 3930402D05Rik
MMRRC Submission 040547-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3031 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location91494647-91529307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91520100 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 433 (V433A)
Ref Sequence ENSEMBL: ENSMUSP00000140151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047242] [ENSMUST00000189341]
Predicted Effect probably damaging
Transcript: ENSMUST00000047242
AA Change: V404A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042391
Gene: ENSMUSG00000034292
AA Change: V404A

DomainStartEndE-ValueType
Pfam:MIP-T3 49 619 7e-207 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187588
Predicted Effect probably damaging
Transcript: ENSMUST00000189341
AA Change: V433A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140151
Gene: ENSMUSG00000034292
AA Change: V433A

DomainStartEndE-ValueType
Pfam:MIP-T3 49 648 7.1e-203 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, cardiac edema, abnormal neural development, polydactyly, and microphthalmia associated with a lack of embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,375,113 V753L probably damaging Het
Ap3b1 T C 13: 94,565,643 L1068P unknown Het
Cacna1h C A 17: 25,433,134 R12L probably damaging Het
Cbln4 A G 2: 172,042,180 V40A probably damaging Het
Ccdc170 T C 10: 4,518,931 S160P probably damaging Het
Cdc37 T C 9: 21,143,191 E46G possibly damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Dsg1a A T 18: 20,340,492 D874V probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hydin A G 8: 110,603,216 R4861G possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lipe T C 7: 25,384,895 E588G possibly damaging Het
Mael T C 1: 166,204,806 D328G probably damaging Het
Mboat7 A G 7: 3,678,688 V398A probably benign Het
Slc35e1 A G 8: 72,484,891 W258R probably benign Het
Slc9a8 A G 2: 167,451,281 D183G probably damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sult3a1 G A 10: 33,877,349 D214N possibly damaging Het
Ubxn7 T A 16: 32,375,307 D232E probably benign Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vps13c T C 9: 67,923,770 S1561P probably benign Het
Wdr48 T C 9: 119,924,110 V593A probably benign Het
Zfp58 A G 13: 67,492,112 F87L probably benign Het
Zfp663 A T 2: 165,353,696 L201* probably null Het
Other mutations in Traf3ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Traf3ip1 APN 1 91518297 missense probably damaging 0.98
IGL01997:Traf3ip1 APN 1 91507570 critical splice donor site probably null
IGL02431:Traf3ip1 APN 1 91499635 missense unknown
IGL03106:Traf3ip1 APN 1 91522887 missense probably benign 0.26
eclectic UTSW 1 91507736 splice site probably null
R0538:Traf3ip1 UTSW 1 91499619 missense unknown
R1034:Traf3ip1 UTSW 1 91518319 splice site probably null
R1065:Traf3ip1 UTSW 1 91500784 missense unknown
R1757:Traf3ip1 UTSW 1 91522857 missense probably damaging 1.00
R2360:Traf3ip1 UTSW 1 91499652 missense unknown
R2367:Traf3ip1 UTSW 1 91507520 missense possibly damaging 0.90
R3752:Traf3ip1 UTSW 1 91500917 splice site probably benign
R3752:Traf3ip1 UTSW 1 91518297 missense probably damaging 0.98
R4690:Traf3ip1 UTSW 1 91520112 missense possibly damaging 0.90
R4747:Traf3ip1 UTSW 1 91527757 missense probably damaging 1.00
R5328:Traf3ip1 UTSW 1 91520069 missense probably damaging 1.00
R5540:Traf3ip1 UTSW 1 91501315 missense probably benign 0.07
R5910:Traf3ip1 UTSW 1 91527745 missense probably damaging 1.00
R6593:Traf3ip1 UTSW 1 91527695 missense possibly damaging 0.82
R6836:Traf3ip1 UTSW 1 91521000 missense probably benign 0.17
R7249:Traf3ip1 UTSW 1 91527639 missense probably damaging 1.00
R7418:Traf3ip1 UTSW 1 91507736 splice site probably null
R7436:Traf3ip1 UTSW 1 91511388 missense probably benign 0.02
R7597:Traf3ip1 UTSW 1 91511445 missense probably damaging 0.97
R7751:Traf3ip1 UTSW 1 91494757 start gained probably benign
R8031:Traf3ip1 UTSW 1 91501419 missense probably damaging 1.00
R8179:Traf3ip1 UTSW 1 91500801 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTCTGAGTGTCATGCCGAC -3'
(R):5'- ATCTGGAATGCTTGCTGCTC -3'

Sequencing Primer
(F):5'- CCGTGGCATGGGAGTGAAC -3'
(R):5'- GGTTTAAGGCAGTGATCTAATCCTC -3'
Posted On2015-02-05