Incidental Mutation 'R3034:Rab36'
ID264791
Institutional Source Beutler Lab
Gene Symbol Rab36
Ensembl Gene ENSMUSG00000020175
Gene NameRAB36, member RAS oncogene family
Synonyms
MMRRC Submission 040550-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3034 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75037058-75054748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75044496 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 63 (V63I)
Ref Sequence ENSEMBL: ENSMUSP00000119399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020391] [ENSMUST00000139384] [ENSMUST00000146440] [ENSMUST00000147802]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020391
AA Change: V63I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020391
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136944
Predicted Effect probably damaging
Transcript: ENSMUST00000139384
AA Change: V63I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118718
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
Pfam:Arf 42 134 6.3e-8 PFAM
Pfam:Ras 74 134 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142507
Predicted Effect probably damaging
Transcript: ENSMUST00000146440
AA Change: V63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121693
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147802
AA Change: V63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119399
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151432
Meta Mutation Damage Score 0.2092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12e T C 11: 70,316,253 I576V probably benign Het
Apol7a T G 15: 77,389,723 I180L probably benign Het
Aptx T C 4: 40,694,994 N114S probably benign Het
Cd40 T A 2: 165,062,315 S65R probably benign Het
Cdh23 C T 10: 60,409,010 probably benign Het
Coro7 G A 16: 4,632,291 R565W probably damaging Het
Cpt1a C T 19: 3,378,390 T588M probably damaging Het
Defb23 A G 2: 152,459,269 S128P possibly damaging Het
Dgki G A 6: 37,087,670 H250Y probably damaging Het
Fgr T C 4: 132,998,496 probably null Het
Fkbp15 T C 4: 62,306,892 probably null Het
Gpr137c C T 14: 45,220,276 S95L probably damaging Het
Kirrel T C 3: 87,083,439 D692G possibly damaging Het
Krt1 C A 15: 101,850,633 R32L unknown Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mrps28 T A 3: 8,923,615 D61V probably benign Het
Mthfd1 A G 12: 76,289,470 K299E probably benign Het
Myo1b A G 1: 51,773,247 Y738H possibly damaging Het
Myo5c A G 9: 75,286,577 T1205A probably benign Het
Nfatc2 C T 2: 168,535,020 G317S probably damaging Het
Nln C T 13: 104,037,439 V525I possibly damaging Het
Nrap T C 19: 56,364,005 E549G probably damaging Het
Nwd2 T A 5: 63,800,103 Y259N probably damaging Het
Oas3 T C 5: 120,771,056 D275G probably damaging Het
Olfr294 A T 7: 86,615,762 D294E possibly damaging Het
Ovch2 A G 7: 107,785,492 S473P probably damaging Het
Pde8b T A 13: 95,222,767 Y16F probably damaging Het
Pmfbp1 A T 8: 109,520,921 probably null Het
Pmvk T C 3: 89,468,517 V74A probably damaging Het
Rbm26 T A 14: 105,153,445 T202S unknown Het
Rheb C T 5: 24,803,723 E166K probably damaging Het
Rnf5 A G 17: 34,603,358 V39A possibly damaging Het
Scn7a T C 2: 66,682,808 Y1168C probably damaging Het
Tas2r114 A G 6: 131,689,648 I139T probably benign Het
Tma7 T C 9: 109,082,206 probably benign Het
Tmem181a T A 17: 6,280,626 S13T possibly damaging Het
Tmem62 C T 2: 120,979,124 probably benign Het
Trim71 T C 9: 114,512,844 D790G probably damaging Het
Trp53tg5 T C 2: 164,471,299 K152R probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Zdbf2 C A 1: 63,304,205 A581E probably damaging Het
Other mutations in Rab36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Rab36 APN 10 75048466 missense probably damaging 1.00
IGL01554:Rab36 APN 10 75050688 missense possibly damaging 0.50
IGL02197:Rab36 APN 10 75052042 missense probably damaging 0.96
R2022:Rab36 UTSW 10 75052474 missense probably benign 0.13
R2907:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R2991:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3012:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3033:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3035:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3036:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3440:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3686:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3687:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3688:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4398:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4426:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4427:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4433:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4456:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4457:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4467:Rab36 UTSW 10 75052043 nonsense probably null
R4689:Rab36 UTSW 10 75041933 critical splice donor site probably null
R5043:Rab36 UTSW 10 75051005 missense probably benign 0.00
R5568:Rab36 UTSW 10 75052479 missense probably benign
R8354:Rab36 UTSW 10 75048459 missense probably damaging 1.00
R8523:Rab36 UTSW 10 75052503 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAGGGTATAACGGTAGGGGC -3'
(R):5'- ACTCCTTGGCCTTTACCACA -3'

Sequencing Primer
(F):5'- GGAGTGTATGTTCTCCCATATCCCAG -3'
(R):5'- ACCCTTCAAACTGTTTCCCAGG -3'
Posted On2015-02-05