Incidental Mutation 'R3686:Rab36'
ID269534
Institutional Source Beutler Lab
Gene Symbol Rab36
Ensembl Gene ENSMUSG00000020175
Gene NameRAB36, member RAS oncogene family
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3686 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75037058-75054748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75044496 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 63 (V63I)
Ref Sequence ENSEMBL: ENSMUSP00000119399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020391] [ENSMUST00000139384] [ENSMUST00000146440] [ENSMUST00000147802]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020391
AA Change: V63I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020391
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136944
Predicted Effect probably damaging
Transcript: ENSMUST00000139384
AA Change: V63I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118718
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
Pfam:Arf 42 134 6.3e-8 PFAM
Pfam:Ras 74 134 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142507
Predicted Effect probably damaging
Transcript: ENSMUST00000146440
AA Change: V63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121693
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147802
AA Change: V63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119399
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151432
Meta Mutation Damage Score 0.2092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb16 T A 11: 102,269,059 D79E probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
B230307C23Rik T A 16: 98,008,999 N62K probably benign Het
B3galnt2 G A 13: 13,975,635 probably null Het
Bnip2 T A 9: 69,999,150 Y118N probably damaging Het
Bptf C A 11: 107,074,198 R1275L probably benign Het
Cacna1g T C 11: 94,459,090 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdh4 T C 2: 179,780,367 S95P probably benign Het
Ceacam5 G A 7: 17,760,823 E919K possibly damaging Het
Eftud2 T C 11: 102,844,201 E624G probably damaging Het
Hr T A 14: 70,557,796 N289K probably damaging Het
Hsp90ab1 A G 17: 45,569,288 Y110H probably damaging Het
Map3k1 A G 13: 111,753,891 V1258A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Nmd3 C T 3: 69,746,762 R413C probably damaging Het
Olfr1301 G T 2: 111,754,569 V107F probably benign Het
Olfr661 A G 7: 104,688,392 I126V probably benign Het
Pgm3 G T 9: 86,559,510 P345T probably benign Het
Ptpn14 C A 1: 189,851,399 D814E probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Ros1 A T 10: 52,145,816 V624E probably damaging Het
Sgo2b T C 8: 63,931,327 K212E probably benign Het
Shisa2 T A 14: 59,629,779 L160Q probably damaging Het
Strn4 A G 7: 16,822,581 Y123C probably damaging Het
Sycp2 T C 2: 178,374,384 T762A probably benign Het
Tiam2 A G 17: 3,421,684 K534E possibly damaging Het
Trdn A T 10: 33,468,189 D633V probably benign Het
Ttn T C 2: 76,916,989 Y4572C possibly damaging Het
Unc79 T A 12: 103,088,661 N921K probably damaging Het
Vmn2r66 A G 7: 84,995,189 V671A probably damaging Het
Wdr86 T A 5: 24,718,341 T118S probably damaging Het
Zfp446 T A 7: 12,982,653 I517N probably damaging Het
Zfp830 G A 11: 82,765,362 E331K possibly damaging Het
Other mutations in Rab36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Rab36 APN 10 75048466 missense probably damaging 1.00
IGL01554:Rab36 APN 10 75050688 missense possibly damaging 0.50
IGL02197:Rab36 APN 10 75052042 missense probably damaging 0.96
R2022:Rab36 UTSW 10 75052474 missense probably benign 0.13
R2907:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R2991:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3012:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3033:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3034:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3035:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3036:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3440:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3687:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3688:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4398:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4426:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4427:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4433:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4456:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4457:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4467:Rab36 UTSW 10 75052043 nonsense probably null
R4689:Rab36 UTSW 10 75041933 critical splice donor site probably null
R5043:Rab36 UTSW 10 75051005 missense probably benign 0.00
R5568:Rab36 UTSW 10 75052479 missense probably benign
R8354:Rab36 UTSW 10 75048459 missense probably damaging 1.00
R8523:Rab36 UTSW 10 75052503 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGACATTGGCCAAAGGGG -3'
(R):5'- GGCCTTTACCACACCCTTCA -3'

Sequencing Primer
(F):5'- GGAGTGTATGTTCTCCCATATCCCAG -3'
(R):5'- AAACTGTTTCCCAGGCTCAGG -3'
Posted On2015-02-19