Incidental Mutation 'R7637:Prss23'
ID590012
Institutional Source Beutler Lab
Gene Symbol Prss23
Ensembl Gene ENSMUSG00000039405
Gene Nameprotease, serine 23
Synonyms2310046G15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7637 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location89507783-89527187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89510246 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 205 (D205V)
Ref Sequence ENSEMBL: ENSMUSP00000045191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041761] [ENSMUST00000207538] [ENSMUST00000207636] [ENSMUST00000207932] [ENSMUST00000208402] [ENSMUST00000208888] [ENSMUST00000208903]
Predicted Effect probably benign
Transcript: ENSMUST00000041761
AA Change: D205V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045191
Gene: ENSMUSG00000039405
AA Change: D205V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 48 57 N/A INTRINSIC
Tryp_SPc 137 372 2.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207538
Predicted Effect probably benign
Transcript: ENSMUST00000207636
Predicted Effect probably benign
Transcript: ENSMUST00000207932
AA Change: D205V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000208402
Predicted Effect probably benign
Transcript: ENSMUST00000208888
Predicted Effect probably benign
Transcript: ENSMUST00000208903
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels of this gene after ovulation was induced. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,218,952 Q651L probably benign Het
Adam8 C T 7: 139,985,430 V624I probably damaging Het
Ccdc144b T A 3: 36,046,876 Q49L probably damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Cmya5 T C 13: 93,083,212 K3243R possibly damaging Het
Dock5 G A 14: 67,786,340 T1124M possibly damaging Het
Fam8a1 A T 13: 46,671,247 M237L probably benign Het
Fars2 G T 13: 36,204,775 K82N probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm5767 C T 16: 8,683,646 P59L unknown Het
Gnat3 A G 5: 18,003,772 D158G Het
Grhl2 A C 15: 37,328,330 N400T probably damaging Het
Grin2c A T 11: 115,256,259 probably null Het
Hipk4 A G 7: 27,523,548 Y11C probably damaging Het
Hspa9 G T 18: 34,938,687 A620E not run Het
Igkv12-89 A G 6: 68,835,099 S29P probably benign Het
Itga8 A T 2: 12,109,187 D1039E probably damaging Het
Itgae A T 11: 73,113,631 D248V probably damaging Het
Kmt2c T C 5: 25,315,095 K2006E probably damaging Het
Mdga1 C T 17: 29,832,379 G934R probably benign Het
Mov10 T C 3: 104,795,885 N896S probably benign Het
Ndufb6 A T 4: 40,273,080 probably null Het
Nlk T C 11: 78,591,005 probably null Het
Notch2 T A 3: 98,146,623 S2201T probably damaging Het
Olfr152 A T 2: 87,783,434 D298V probably damaging Het
Pank1 A C 19: 34,821,988 probably null Het
Pdlim3 T C 8: 45,909,065 F126S probably damaging Het
Pds5a C A 5: 65,638,604 G648C probably benign Het
Plekhh3 T C 11: 101,164,327 I567V unknown Het
Ppfia2 T C 10: 106,865,403 probably null Het
Prl3d1 A G 13: 27,100,069 D207G probably damaging Het
Pygl C T 12: 70,197,795 probably null Het
Qsox2 A G 2: 26,221,020 F111S probably damaging Het
Sart3 T C 5: 113,771,352 N95S probably benign Het
Scpep1 A G 11: 88,929,220 F414S probably damaging Het
Selenbp1 C A 3: 94,937,348 Y105* probably null Het
Sirpa A G 2: 129,616,445 D327G probably benign Het
Sowahc G A 10: 59,222,183 R47H probably damaging Het
Szt2 T C 4: 118,393,828 Y361C probably damaging Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tie1 T C 4: 118,472,978 I1042M probably damaging Het
Tmem132e T A 11: 82,434,516 L114Q probably damaging Het
Tmx3 A G 18: 90,537,109 T317A probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Tpr T C 1: 150,423,516 Y1156H probably damaging Het
Trank1 A C 9: 111,365,296 D796A possibly damaging Het
Tsc2 G A 17: 24,607,492 P928S probably benign Het
Unc80 G T 1: 66,672,684 V2722F possibly damaging Het
Vmn1r199 G T 13: 22,382,675 L46F probably benign Het
Vps13a A T 19: 16,750,149 H196Q probably benign Het
Wnt10a T A 1: 74,793,474 C75* probably null Het
Zfp335 A G 2: 164,892,539 probably null Het
Other mutations in Prss23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Prss23 APN 7 89509887 missense possibly damaging 0.83
IGL03308:Prss23 APN 7 89509730 missense probably benign 0.09
IGL03349:Prss23 APN 7 89509857 missense probably benign 0.09
IGL03378:Prss23 APN 7 89510144 missense probably damaging 0.99
R0394:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R1026:Prss23 UTSW 7 89509958 missense probably benign 0.01
R1417:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1691:Prss23 UTSW 7 89510714 missense probably benign 0.18
R1806:Prss23 UTSW 7 89510391 missense probably damaging 1.00
R2153:Prss23 UTSW 7 89509911 missense probably damaging 1.00
R3420:Prss23 UTSW 7 89509899 missense possibly damaging 0.91
R3849:Prss23 UTSW 7 89509751 missense probably damaging 1.00
R4567:Prss23 UTSW 7 89510866 utr 5 prime probably benign
R4828:Prss23 UTSW 7 89509900 nonsense probably null
R5010:Prss23 UTSW 7 89510214 missense probably benign 0.25
R5251:Prss23 UTSW 7 89510322 missense probably damaging 1.00
R5399:Prss23 UTSW 7 89509966 missense probably benign 0.02
R5629:Prss23 UTSW 7 89510192 missense probably damaging 1.00
R5697:Prss23 UTSW 7 89509982 missense probably damaging 0.99
R6378:Prss23 UTSW 7 89510033 missense probably damaging 1.00
R6716:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R6880:Prss23 UTSW 7 89510825 missense probably benign 0.03
R7097:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R7362:Prss23 UTSW 7 89509764 missense probably damaging 1.00
R7563:Prss23 UTSW 7 89509830 missense probably damaging 1.00
R7815:Prss23 UTSW 7 89510045 missense probably damaging 0.99
R8047:Prss23 UTSW 7 89509928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAACCAGAGAAGTGGATCCTGC -3'
(R):5'- TTTCTCAACATCGGTGAAGTTG -3'

Sequencing Primer
(F):5'- TGGAGGACTCACACCAATCTTCATG -3'
(R):5'- CTCAACATCGGTGAAGTTGTCTACTG -3'
Posted On2019-10-24