Incidental Mutation 'R3436:Prr16'
ID267212
Institutional Source Beutler Lab
Gene Symbol Prr16
Ensembl Gene ENSMUSG00000073565
Gene Nameproline rich 16
Synonyms5430406M13Rik
MMRRC Submission 040654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3436 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location51117898-51304641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51303123 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 225 (N225D)
Ref Sequence ENSEMBL: ENSMUSP00000112338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116639]
Predicted Effect probably benign
Transcript: ENSMUST00000116639
AA Change: N225D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112338
Gene: ENSMUSG00000073565
AA Change: N225D

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:DUF4589 53 304 4.4e-80 PFAM
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambp T C 4: 63,149,484 E163G probably benign Het
Angptl3 A T 4: 99,033,303 K219N probably benign Het
Atp6v1g1 A G 4: 63,550,018 N86S probably benign Het
Cadps A T 14: 12,616,158 probably null Het
Ccdc146 A G 5: 21,297,005 S804P possibly damaging Het
Cdc20b T C 13: 113,078,699 I267T probably damaging Het
Cdh8 A G 8: 99,400,718 probably benign Het
Dse G T 10: 34,152,474 N873K probably benign Het
Ehd1 G T 19: 6,277,014 E14* probably null Het
F8 A G X: 75,267,424 probably benign Het
Flnb T C 14: 7,942,057 V2345A probably damaging Het
Fndc1 T C 17: 7,750,357 K1559E probably damaging Het
Ighg1 T C 12: 113,329,560 E170G probably damaging Het
Kmt2b G T 7: 30,576,692 P1794Q probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Med25 C A 7: 44,885,890 R37L possibly damaging Het
Olfr1189 T A 2: 88,592,104 F100Y probably damaging Het
Olfr136 A G 17: 38,335,432 I92V probably damaging Het
Olfr138 G A 17: 38,275,530 G253D probably damaging Het
Optc T C 1: 133,897,879 D303G probably damaging Het
Pkd1l2 T C 8: 117,040,739 N1271D probably benign Het
Plpp2 A T 10: 79,527,813 probably null Het
Polq A T 16: 37,062,337 N1342I probably damaging Het
Pwwp2a C T 11: 43,706,188 Q452* probably null Het
Slfn2 A T 11: 83,069,564 H123L probably benign Het
Sort1 T A 3: 108,337,807 I325N probably damaging Het
Tmem132e A G 11: 82,444,330 Y654C probably damaging Het
Tmprss11b A T 5: 86,667,584 Y48* probably null Het
Tpp2 T C 1: 43,940,144 I67T probably damaging Het
Trdn G A 10: 33,468,195 probably null Het
Trim14 C T 4: 46,523,739 V100I possibly damaging Het
Trim17 T C 11: 58,965,233 C39R probably damaging Het
Trim52 C T 14: 106,107,307 P133L possibly damaging Het
Unc13b T C 4: 43,097,028 probably benign Het
Vmn2r94 G A 17: 18,258,388 probably benign Het
Vsig4 A G X: 96,290,816 V29A probably benign Het
Washc4 T A 10: 83,570,002 I454N probably benign Het
Wnk3 T A X: 151,286,304 F886I probably benign Het
Ylpm1 T C 12: 85,049,870 probably null Het
Zfp507 A T 7: 35,787,770 Y234N probably damaging Het
Other mutations in Prr16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Prr16 APN 18 51303120 missense possibly damaging 0.82
IGL00951:Prr16 APN 18 51303339 missense probably damaging 1.00
IGL01744:Prr16 APN 18 51302989 missense possibly damaging 0.73
IGL02345:Prr16 APN 18 51303229 missense probably damaging 1.00
IGL02833:Prr16 APN 18 51303092 missense probably damaging 1.00
LCD18:Prr16 UTSW 18 51200324 intron probably benign
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1195:Prr16 UTSW 18 51302683 missense probably damaging 1.00
R1572:Prr16 UTSW 18 51302970 missense probably benign 0.01
R1988:Prr16 UTSW 18 51303277 missense probably damaging 1.00
R3685:Prr16 UTSW 18 51302820 missense probably damaging 0.99
R4609:Prr16 UTSW 18 51118067 missense possibly damaging 0.79
R4626:Prr16 UTSW 18 51302839 missense probably damaging 1.00
R5443:Prr16 UTSW 18 51303153 missense probably damaging 1.00
R5713:Prr16 UTSW 18 51302838 missense probably damaging 1.00
R6525:Prr16 UTSW 18 51303155 missense probably benign 0.01
Z1176:Prr16 UTSW 18 51303150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACATCTGCTGCATACCC -3'
(R):5'- ATGGCAGATATCACACTGTGG -3'

Sequencing Primer
(F):5'- TGCTGCATACCCAACAGTAACTTG -3'
(R):5'- GGATTTCCTCAGGATGGTCTTC -3'
Posted On2015-02-18