Incidental Mutation 'R3695:Hsp90ab1'
ID268957
Institutional Source Beutler Lab
Gene Symbol Hsp90ab1
Ensembl Gene ENSMUSG00000023944
Gene Nameheat shock protein 90 alpha (cytosolic), class B member 1
SynonymsHspcb, Hsp84, Hsp90, C81438, Hsp84-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3695 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45567775-45573271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45571477 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 97 (D97G)
Ref Sequence ENSEMBL: ENSMUSP00000024739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000041353] [ENSMUST00000130406] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905]
Predicted Effect probably damaging
Transcript: ENSMUST00000024739
AA Change: D97G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944
AA Change: D97G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041353
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130406
SMART Domains Protein: ENSMUSP00000119678
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 76 2e-32 SMART
PDB:1UYM|A 14 76 7e-38 PDB
Blast:HATPase_c 35 76 3e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151306
Predicted Effect probably benign
Transcript: ENSMUST00000163966
AA Change: T85A

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944
AA Change: T85A

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224559
Predicted Effect probably benign
Transcript: ENSMUST00000224905
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a gene-trapped null mutation exhibit placental defects including failure to form a placental labyrinth and lack of expansion of allantoic blood vessels. Mutants die around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn7l1 A G 12: 33,358,697 N286S probably damaging Het
B430306N03Rik C T 17: 48,319,166 T129I possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Gabrr2 A G 4: 33,071,430 D65G probably damaging Het
Grin3a G T 4: 49,792,704 T343K possibly damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Mdm4 A G 1: 132,991,993 L379S probably benign Het
Olfr1062 T C 2: 86,423,643 E11G probably damaging Het
Olfr1090 A T 2: 86,753,871 I289N probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Pkd2l2 A G 18: 34,438,790 N614S possibly damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Skiv2l A G 17: 34,847,912 F154S probably damaging Het
St3gal2 A G 8: 110,962,341 D171G probably damaging Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syk A G 13: 52,622,765 probably null Het
Tgs1 A G 4: 3,604,949 probably null Het
Tlr5 A T 1: 182,975,347 R739W probably damaging Het
Tns2 G T 15: 102,112,749 V942L probably null Het
Tsnaxip1 A G 8: 105,833,535 T40A possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Wscd2 T A 5: 113,551,017 I28N possibly damaging Het
Other mutations in Hsp90ab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Hsp90ab1 APN 17 45569564 missense probably damaging 0.96
IGL02234:Hsp90ab1 APN 17 45569735 missense probably benign 0.01
IGL02275:Hsp90ab1 APN 17 45568438 missense possibly damaging 0.76
IGL03069:Hsp90ab1 APN 17 45569028 missense possibly damaging 0.65
IGL03104:Hsp90ab1 APN 17 45571523 missense probably damaging 0.99
R0457:Hsp90ab1 UTSW 17 45568988 missense probably damaging 1.00
R0787:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R0788:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R0790:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R1142:Hsp90ab1 UTSW 17 45568974 nonsense probably null
R1738:Hsp90ab1 UTSW 17 45571806 missense probably damaging 1.00
R2109:Hsp90ab1 UTSW 17 45569328 missense probably benign 0.32
R2156:Hsp90ab1 UTSW 17 45569703 missense possibly damaging 0.82
R2509:Hsp90ab1 UTSW 17 45569341 missense probably damaging 1.00
R3686:Hsp90ab1 UTSW 17 45569288 missense probably damaging 1.00
R3700:Hsp90ab1 UTSW 17 45571514 missense possibly damaging 0.69
R4968:Hsp90ab1 UTSW 17 45571036 missense probably benign 0.05
R5809:Hsp90ab1 UTSW 17 45570649 unclassified probably benign
R6833:Hsp90ab1 UTSW 17 45570467 missense probably benign
R6834:Hsp90ab1 UTSW 17 45570467 missense probably benign
R7392:Hsp90ab1 UTSW 17 45569048 missense probably benign 0.10
R7400:Hsp90ab1 UTSW 17 45569284 missense probably benign 0.04
R7584:Hsp90ab1 UTSW 17 45570271 missense probably damaging 1.00
R7834:Hsp90ab1 UTSW 17 45571165 missense possibly damaging 0.85
R7851:Hsp90ab1 UTSW 17 45570452 missense probably benign 0.17
R7917:Hsp90ab1 UTSW 17 45571165 missense possibly damaging 0.85
R7934:Hsp90ab1 UTSW 17 45570452 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCAAAGCTGTCCTGACCAAC -3'
(R):5'- AACAGTTCAGTTGATGTTGAAGGG -3'

Sequencing Primer
(F):5'- AGCTGTCCTGACCAACCACTTG -3'
(R):5'- CAGTTGATGTTGAAGGGGGAGG -3'
Posted On2015-02-19