Incidental Mutation 'R3624:Emilin3'
ID269302
Institutional Source Beutler Lab
Gene Symbol Emilin3
Ensembl Gene ENSMUSG00000050700
Gene Nameelastin microfibril interfacer 3
SynonymsEmilin5, EMILIN-T
MMRRC Submission 040678-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3624 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160906437-160912328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160908257 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 477 (D477G)
Ref Sequence ENSEMBL: ENSMUSP00000105080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
Predicted Effect probably benign
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057169
AA Change: D524G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700
AA Change: D524G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109454
AA Change: D477G

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700
AA Change: D477G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124920
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adcy2 T C 13: 68,642,531 T905A probably damaging Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Anks1 T C 17: 27,986,288 F274L probably damaging Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
Colec11 T C 12: 28,594,908 M196V probably benign Het
Cyp2c54 A G 19: 40,070,244 I248T probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Esp4 A G 17: 40,602,593 K117R unknown Het
Fam186b A G 15: 99,280,515 L310S probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap C T 4: 56,798,708 V85M possibly damaging Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itih3 A G 14: 30,914,743 Y38H probably damaging Het
Kif21a A G 15: 90,965,595 V35A probably damaging Het
Klhl14 A T 18: 21,557,896 V499D probably damaging Het
Kmt2d T C 15: 98,842,902 probably benign Het
Loxl4 A G 19: 42,607,576 V146A probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Racgap1 T A 15: 99,642,891 N26I probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Smad1 A G 8: 79,339,698 V450A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Spag11a A G 8: 19,159,401 D69G probably benign Het
Sptbn1 T C 11: 30,140,593 H559R probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Trim54 G A 5: 31,136,976 V319M possibly damaging Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Uhrf1 C T 17: 56,317,023 T482I probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn1r88 A C 7: 13,177,863 M49L probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zkscan8 C T 13: 21,520,776 R259Q probably damaging Het
Other mutations in Emilin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Emilin3 APN 2 160909783 missense probably damaging 1.00
IGL02231:Emilin3 APN 2 160908515 missense probably damaging 1.00
IGL02812:Emilin3 APN 2 160908729 nonsense probably null
IGL02813:Emilin3 APN 2 160908729 nonsense probably null
IGL02892:Emilin3 APN 2 160909149 missense possibly damaging 0.72
IGL03012:Emilin3 APN 2 160908729 nonsense probably null
IGL03017:Emilin3 APN 2 160908729 nonsense probably null
IGL03083:Emilin3 APN 2 160908729 nonsense probably null
IGL03094:Emilin3 APN 2 160908729 nonsense probably null
IGL03163:Emilin3 APN 2 160908729 nonsense probably null
IGL03206:Emilin3 APN 2 160910799 missense probably damaging 1.00
IGL02835:Emilin3 UTSW 2 160908729 nonsense probably null
IGL03046:Emilin3 UTSW 2 160908729 nonsense probably null
PIT1430001:Emilin3 UTSW 2 160908482 missense possibly damaging 0.48
R0373:Emilin3 UTSW 2 160909817 missense probably benign 0.00
R0392:Emilin3 UTSW 2 160910879 unclassified probably benign
R0420:Emilin3 UTSW 2 160910879 unclassified probably benign
R0627:Emilin3 UTSW 2 160908176 missense probably damaging 1.00
R0628:Emilin3 UTSW 2 160910879 unclassified probably benign
R0671:Emilin3 UTSW 2 160908329 missense probably damaging 1.00
R1655:Emilin3 UTSW 2 160910866 critical splice acceptor site probably null
R2016:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R2017:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R4062:Emilin3 UTSW 2 160907796 missense probably benign
R4307:Emilin3 UTSW 2 160908317 missense probably damaging 1.00
R4365:Emilin3 UTSW 2 160908486 missense probably benign
R4669:Emilin3 UTSW 2 160910797 missense probably benign 0.00
R5076:Emilin3 UTSW 2 160909318 critical splice acceptor site probably null
R5227:Emilin3 UTSW 2 160909265 missense probably damaging 1.00
R5725:Emilin3 UTSW 2 160908490 nonsense probably null
R5914:Emilin3 UTSW 2 160909070 missense probably damaging 1.00
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6919:Emilin3 UTSW 2 160908098 missense probably damaging 1.00
R7353:Emilin3 UTSW 2 160908821 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGAGAGTGATCTCCCCTTGC -3'
(R):5'- GCTGCTGTCTGAGAATGGAG -3'

Sequencing Primer
(F):5'- AGTGATCTCCCCTTGCAGTGAG -3'
(R):5'- GAACAGCGAGTGCAGAGCC -3'
Posted On2015-02-19