Incidental Mutation 'R5227:Emilin3'
ID402659
Institutional Source Beutler Lab
Gene Symbol Emilin3
Ensembl Gene ENSMUSG00000050700
Gene Nameelastin microfibril interfacer 3
SynonymsEmilin5, EMILIN-T
MMRRC Submission 042800-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5227 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160906437-160912328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 160909265 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 188 (Q188L)
Ref Sequence ENSEMBL: ENSMUSP00000059732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
Predicted Effect probably benign
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057169
AA Change: Q188L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700
AA Change: Q188L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109454
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.2%
  • 20x: 97.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,691,821 L115P probably damaging Het
Adgrb3 A C 1: 25,093,952 M481R possibly damaging Het
Adgrd1 C A 5: 129,122,583 N161K probably benign Het
Alx4 T A 2: 93,677,380 V340D probably damaging Het
Arid1a A G 4: 133,680,405 S2264P unknown Het
Azi2 A T 9: 118,047,458 H14L probably damaging Het
Camsap2 A G 1: 136,274,891 probably benign Het
Ccpg1 T A 9: 73,012,072 L323* probably null Het
Cpsf1 A T 15: 76,598,948 I943N probably damaging Het
Crebrf T A 17: 26,759,765 Y476N probably damaging Het
Defb10 T A 8: 21,861,878 Y46* probably null Het
Dock3 A G 9: 106,986,070 L703P probably damaging Het
Ebf2 A T 14: 67,247,069 I181F probably damaging Het
Eif3e T A 15: 43,251,521 M420L probably benign Het
Elmsan1 A T 12: 84,152,887 F1020I probably benign Het
Fbxl4 C T 4: 22,376,840 T92M probably damaging Het
Fer1l6 C T 15: 58,581,903 Q687* probably null Het
Fkrp T C 7: 16,810,710 E409G possibly damaging Het
Fzd9 T C 5: 135,249,606 D475G probably benign Het
Gabbr1 C T 17: 37,070,066 T767I possibly damaging Het
Gdf2 G A 14: 33,941,494 probably null Het
Gpatch1 T C 7: 35,309,351 N82D probably benign Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ireb2 T A 9: 54,896,601 probably null Het
Kansl1 T G 11: 104,356,814 H570P probably benign Het
Kcna10 T G 3: 107,194,428 M125R probably damaging Het
Lrp1b T G 2: 40,851,793 I3041L possibly damaging Het
Mbtd1 T C 11: 93,924,648 F354S possibly damaging Het
Mov10 T C 3: 104,802,578 T331A probably benign Het
Ms4a8a A T 19: 11,068,416 S243T probably damaging Het
Ndufa11 T C 17: 56,717,867 S10P probably benign Het
Olfml3 A G 3: 103,736,421 Y215H possibly damaging Het
Olfr315 T A 11: 58,778,879 F251I possibly damaging Het
Olfr663 A G 7: 104,704,322 I252V possibly damaging Het
Pclo T C 5: 14,713,560 S4016P probably benign Het
Pcyox1 G C 6: 86,391,744 A264G probably damaging Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Pnisr A G 4: 21,874,587 probably benign Het
Prc1 T C 7: 80,313,179 S574P probably damaging Het
Ranbp3l T A 15: 9,007,312 V16D probably damaging Het
Rfx1 T C 8: 84,074,058 V96A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfmbt1 T C 14: 30,815,254 probably null Het
Siglecf T C 7: 43,351,940 Y111H probably damaging Het
Snx14 G A 9: 88,398,294 T536I possibly damaging Het
Spindoc A G 19: 7,374,147 V204A probably benign Het
Sptbn5 A G 2: 120,085,331 probably benign Het
Swt1 G A 1: 151,402,976 Q227* probably null Het
Tg A G 15: 66,759,567 I562V possibly damaging Het
Trip11 T A 12: 101,884,920 I677F probably damaging Het
Vmn1r49 G A 6: 90,072,771 T83I probably benign Het
Vmn1r90 T C 7: 14,561,676 K166E possibly damaging Het
Vmn2r124 T C 17: 18,049,557 I25T possibly damaging Het
Vps13d A T 4: 145,181,207 probably null Het
Zfp106 T C 2: 120,523,968 I170V probably benign Het
Other mutations in Emilin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Emilin3 APN 2 160909783 missense probably damaging 1.00
IGL02231:Emilin3 APN 2 160908515 missense probably damaging 1.00
IGL02812:Emilin3 APN 2 160908729 nonsense probably null
IGL02813:Emilin3 APN 2 160908729 nonsense probably null
IGL02892:Emilin3 APN 2 160909149 missense possibly damaging 0.72
IGL03012:Emilin3 APN 2 160908729 nonsense probably null
IGL03017:Emilin3 APN 2 160908729 nonsense probably null
IGL03083:Emilin3 APN 2 160908729 nonsense probably null
IGL03094:Emilin3 APN 2 160908729 nonsense probably null
IGL03163:Emilin3 APN 2 160908729 nonsense probably null
IGL03206:Emilin3 APN 2 160910799 missense probably damaging 1.00
IGL02835:Emilin3 UTSW 2 160908729 nonsense probably null
IGL03046:Emilin3 UTSW 2 160908729 nonsense probably null
PIT1430001:Emilin3 UTSW 2 160908482 missense possibly damaging 0.48
R0373:Emilin3 UTSW 2 160909817 missense probably benign 0.00
R0392:Emilin3 UTSW 2 160910879 unclassified probably benign
R0420:Emilin3 UTSW 2 160910879 unclassified probably benign
R0627:Emilin3 UTSW 2 160908176 missense probably damaging 1.00
R0628:Emilin3 UTSW 2 160910879 unclassified probably benign
R0671:Emilin3 UTSW 2 160908329 missense probably damaging 1.00
R1655:Emilin3 UTSW 2 160910866 critical splice acceptor site probably null
R2016:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R2017:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R3624:Emilin3 UTSW 2 160908257 missense possibly damaging 0.59
R4062:Emilin3 UTSW 2 160907796 missense probably benign
R4307:Emilin3 UTSW 2 160908317 missense probably damaging 1.00
R4365:Emilin3 UTSW 2 160908486 missense probably benign
R4669:Emilin3 UTSW 2 160910797 missense probably benign 0.00
R5076:Emilin3 UTSW 2 160909318 critical splice acceptor site probably null
R5725:Emilin3 UTSW 2 160908490 nonsense probably null
R5914:Emilin3 UTSW 2 160909070 missense probably damaging 1.00
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6919:Emilin3 UTSW 2 160908098 missense probably damaging 1.00
R7353:Emilin3 UTSW 2 160908821 missense probably damaging 0.99
R7618:Emilin3 UTSW 2 160909279 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGCACCTTGGTCTGTAATGTG -3'
(R):5'- TGAGCCATGACTGTAAAACCC -3'

Sequencing Primer
(F):5'- GTAATGTGTTGCTCACCTCTGTGAC -3'
(R):5'- GATAACATGTTGGAGGGC -3'
Posted On2016-07-22