Incidental Mutation 'R3685:Olfr1246'
ID269497
Institutional Source Beutler Lab
Gene Symbol Olfr1246
Ensembl Gene ENSMUSG00000111715
Gene Nameolfactory receptor 1246
SynonymsGA_x6K02T2Q125-51034790-51033846, MOR231-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R3685 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89586141-89593157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89590755 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 120 (R120L)
Ref Sequence ENSEMBL: ENSMUSP00000150876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187990] [ENSMUST00000213221] [ENSMUST00000217192] [ENSMUST00000217254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099772
AA Change: R120L

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097360
Gene: ENSMUSG00000075082
AA Change: R120L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.5e-47 PFAM
Pfam:7tm_1 39 285 4.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187990
AA Change: R120L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140066
Gene: ENSMUSG00000111715
AA Change: R120L

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.7e-28 PFAM
Pfam:7tm_4 137 278 3.5e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191053
AA Change: R120L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140823
Gene: ENSMUSG00000100828
AA Change: R120L

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 1.9e-29 PFAM
Pfam:7tm_4 137 278 1.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213221
AA Change: R120L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217192
AA Change: R120L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217254
AA Change: R120L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 T C 4: 133,065,702 L1418P possibly damaging Het
Atp13a5 G C 16: 29,316,755 L340V probably damaging Het
Cdon A G 9: 35,489,032 E1014G possibly damaging Het
Cyp2c40 A G 19: 39,786,779 M343T possibly damaging Het
Dmrtc2 T C 7: 24,874,262 V174A probably benign Het
Ggta1 T A 2: 35,407,988 T162S probably benign Het
Gm9637 A G 14: 19,401,950 noncoding transcript Het
Gpbp1 T C 13: 111,466,871 T15A probably benign Het
Itih5 A T 2: 10,238,624 N391Y possibly damaging Het
Klhl40 A G 9: 121,782,658 E579G probably damaging Het
Olfr1164 T A 2: 88,093,259 I226F probably damaging Het
Olfr1223 A T 2: 89,145,020 M1K probably null Het
Prr16 C A 18: 51,302,820 P124T probably damaging Het
Ribc2 A G 15: 85,135,334 T106A possibly damaging Het
Slc37a1 C A 17: 31,325,693 T253N probably benign Het
Smpd1 T A 7: 105,555,402 C163S probably damaging Het
Tacc2 A G 7: 130,625,070 S1162G probably benign Het
Tenm2 C A 11: 36,051,817 V1342L probably benign Het
Trim34a T C 7: 104,260,126 probably null Het
Zfand6 G A 7: 84,634,362 P11S probably damaging Het
Other mutations in Olfr1246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr1246 APN 2 89590242 missense probably damaging 1.00
IGL02184:Olfr1246 APN 2 89590293 missense probably damaging 0.99
IGL03383:Olfr1246 APN 2 89590312 missense probably benign 0.24
PIT4283001:Olfr1246 UTSW 2 89590228 missense probably benign 0.01
R0453:Olfr1246 UTSW 2 89590751 nonsense probably null
R1614:Olfr1246 UTSW 2 89590696 missense possibly damaging 0.76
R2310:Olfr1246 UTSW 2 89590450 missense probably damaging 0.99
R2436:Olfr1246 UTSW 2 89590773 missense probably benign 0.42
R3683:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R4037:Olfr1246 UTSW 2 89591035 missense probably benign 0.02
R5219:Olfr1246 UTSW 2 89590702 missense probably benign 0.03
R5350:Olfr1246 UTSW 2 89591088 missense possibly damaging 0.59
R5383:Olfr1246 UTSW 2 89591113 start codon destroyed probably null 0.91
R5639:Olfr1246 UTSW 2 89590725 missense probably damaging 1.00
R5927:Olfr1246 UTSW 2 89591100 missense possibly damaging 0.93
R6056:Olfr1246 UTSW 2 89591101 missense possibly damaging 0.93
R6177:Olfr1246 UTSW 2 89590317 missense possibly damaging 0.78
R7351:Olfr1246 UTSW 2 89590513 missense probably benign 0.32
R7496:Olfr1246 UTSW 2 89590696 missense probably benign 0.05
R7583:Olfr1246 UTSW 2 89590751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTCAGTGCACACAAGTCC -3'
(R):5'- CCTGCTCATTGTGCTGATGG -3'

Sequencing Primer
(F):5'- GTCAGTGCACACAAGTCCCAATAATG -3'
(R):5'- TGATGGTGATTGCCAGCCC -3'
Posted On2015-02-19