Incidental Mutation 'R5350:Olfr1246'
ID423735
Institutional Source Beutler Lab
Gene Symbol Olfr1246
Ensembl Gene ENSMUSG00000111715
Gene Nameolfactory receptor 1246
SynonymsGA_x6K02T2Q125-51034790-51033846, MOR231-9
MMRRC Submission 042929-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5350 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89586141-89593157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89591088 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 9 (E9V)
Ref Sequence ENSEMBL: ENSMUSP00000150876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187990] [ENSMUST00000213221] [ENSMUST00000217192] [ENSMUST00000217254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000187990
AA Change: E9V

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140066
Gene: ENSMUSG00000111715
AA Change: E9V

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.7e-28 PFAM
Pfam:7tm_4 137 278 3.5e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191053
AA Change: E9V

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140823
Gene: ENSMUSG00000100828
AA Change: E9V

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 1.9e-29 PFAM
Pfam:7tm_4 137 278 1.1e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213221
AA Change: E9V

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217192
AA Change: E9V

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217254
AA Change: E9V

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Abca9 A G 11: 110,115,538 V1247A probably benign Het
Acaca A T 11: 84,215,873 M133L probably damaging Het
Acacb C T 5: 114,244,551 A2100V probably damaging Het
Adamts16 T A 13: 70,753,196 K921* probably null Het
Ankrd55 T G 13: 112,336,226 V144G probably damaging Het
Arap3 A G 18: 37,982,035 L976P probably damaging Het
Atg2a T A 19: 6,251,338 V814E probably damaging Het
Atp2b2 A T 6: 113,759,238 M960K probably damaging Het
Bag1 C T 4: 40,948,007 G66S possibly damaging Het
Bmp8a A T 4: 123,313,295 M391K probably damaging Het
Capns1 C A 7: 30,190,126 R216L probably damaging Het
Cdk13 T C 13: 17,803,930 probably benign Het
Cmtm3 T C 8: 104,343,833 F75L probably damaging Het
Cops4 T A 5: 100,518,539 D21E possibly damaging Het
Dach1 G T 14: 97,969,959 A318E probably damaging Het
Ddx27 A G 2: 167,027,860 probably benign Het
Disp2 A G 2: 118,787,575 T201A probably benign Het
Dnah2 G T 11: 69,516,036 D214E possibly damaging Het
Dnah7b G T 1: 46,233,689 G2326C probably benign Het
Dusp5 T C 19: 53,541,234 F356S probably damaging Het
Duxf3 C A 10: 58,231,093 S528I probably damaging Het
Ell T A 8: 70,539,789 V28E probably damaging Het
Evi5 C T 5: 107,815,678 D344N probably benign Het
Fv1 G T 4: 147,870,089 V371L possibly damaging Het
Gemin5 A G 11: 58,141,586 probably null Het
Glce A T 9: 62,060,305 Y521* probably null Het
Grn T A 11: 102,436,244 L556Q possibly damaging Het
Icam1 C A 9: 21,027,886 Y518* probably null Het
Jag2 A T 12: 112,908,922 S1237R possibly damaging Het
Macf1 A T 4: 123,527,458 M1K probably null Het
Nbea T C 3: 56,019,424 E786G probably damaging Het
Nr4a2 A G 2: 57,111,865 M192T probably damaging Het
Olfr1396 T C 11: 49,113,052 T225A probably benign Het
Olfr591 T A 7: 103,173,559 H26L probably damaging Het
Olfr860 A T 9: 19,846,616 M1K probably null Het
Pcnx4 A C 12: 72,579,364 N1115H probably damaging Het
Ppargc1b A G 18: 61,309,063 S585P possibly damaging Het
Ppip5k2 C T 1: 97,721,128 S1024N probably damaging Het
Prkar1b C T 5: 139,106,628 E145K probably damaging Het
Psd3 T A 8: 67,908,861 T539S probably benign Het
Rit2 A G 18: 31,316,852 V31A probably damaging Het
Rps6kc1 G A 1: 190,799,466 P780S probably benign Het
Serpina6 G T 12: 103,648,579 T336K possibly damaging Het
Smo A T 6: 29,754,467 Q232L probably benign Het
Stx2 T C 5: 128,991,091 D184G probably damaging Het
Tmprss11d T C 5: 86,338,887 Y48C probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Other mutations in Olfr1246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr1246 APN 2 89590242 missense probably damaging 1.00
IGL02184:Olfr1246 APN 2 89590293 missense probably damaging 0.99
IGL03383:Olfr1246 APN 2 89590312 missense probably benign 0.24
PIT4283001:Olfr1246 UTSW 2 89590228 missense probably benign 0.01
R0453:Olfr1246 UTSW 2 89590751 nonsense probably null
R1614:Olfr1246 UTSW 2 89590696 missense possibly damaging 0.76
R2310:Olfr1246 UTSW 2 89590450 missense probably damaging 0.99
R2436:Olfr1246 UTSW 2 89590773 missense probably benign 0.42
R3683:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R3685:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R4037:Olfr1246 UTSW 2 89591035 missense probably benign 0.02
R5219:Olfr1246 UTSW 2 89590702 missense probably benign 0.03
R5383:Olfr1246 UTSW 2 89591113 start codon destroyed probably null 0.91
R5639:Olfr1246 UTSW 2 89590725 missense probably damaging 1.00
R5927:Olfr1246 UTSW 2 89591100 missense possibly damaging 0.93
R6056:Olfr1246 UTSW 2 89591101 missense possibly damaging 0.93
R6177:Olfr1246 UTSW 2 89590317 missense possibly damaging 0.78
R7351:Olfr1246 UTSW 2 89590513 missense probably benign 0.32
R7496:Olfr1246 UTSW 2 89590696 missense probably benign 0.05
R7583:Olfr1246 UTSW 2 89590751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAAGTCCATAATCAACTTTGGTG -3'
(R):5'- TGAGGTCGTGAGAAACAGTTC -3'

Sequencing Primer
(F):5'- GTCCATAATCAACTTTGGTGAGATGG -3'
(R):5'- AGGTCGTGAGAAACAGTTCTACTTG -3'
Posted On2016-08-04