Incidental Mutation 'R3761:Or10d1c'
ID 270539
Institutional Source Beutler Lab
Gene Symbol Or10d1c
Ensembl Gene ENSMUSG00000057424
Gene Name olfactory receptor family 10 subfamily D member 1C
Synonyms GA_x6K02T2PVTD-32678895-32677963, Olfr934, MOR224-6
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R3761 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38893406-38894338 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38893662 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 226 (I226N)
Ref Sequence ENSEMBL: ENSMUSP00000150864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074211] [ENSMUST00000214324] [ENSMUST00000216238] [ENSMUST00000216823]
AlphaFold Q9EQ87
Predicted Effect possibly damaging
Transcript: ENSMUST00000074211
AA Change: I226N

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073835
Gene: ENSMUSG00000057424
AA Change: I226N

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 33 222 7.2e-9 PFAM
Pfam:7tm_1 39 286 5.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214324
AA Change: I226N

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000216238
Predicted Effect possibly damaging
Transcript: ENSMUST00000216823
AA Change: I226N

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A G 9: 110,727,202 (GRCm39) T923A probably damaging Het
Ccdc91 A T 6: 147,464,200 (GRCm39) D216V unknown Het
Clstn3 A G 6: 124,434,835 (GRCm39) V360A possibly damaging Het
Ct45a C T X: 55,590,568 (GRCm39) V78I probably benign Het
Ehmt2 A G 17: 35,132,707 (GRCm39) I1235V probably damaging Het
Eif3e C T 15: 43,124,480 (GRCm39) R346H probably damaging Het
Esrp2 T C 8: 106,860,254 (GRCm39) D301G probably damaging Het
Fam174a G T 1: 95,241,971 (GRCm39) V144F probably damaging Het
Fbxo31 A T 8: 122,287,169 (GRCm39) W135R possibly damaging Het
Heatr5b A G 17: 79,137,071 (GRCm39) S150P probably damaging Het
Il16 A G 7: 83,300,093 (GRCm39) L400S possibly damaging Het
Ryr3 A G 2: 112,585,258 (GRCm39) F2776S probably benign Het
Sema3d T C 5: 12,621,004 (GRCm39) Y537H probably damaging Het
Sh3pxd2b T C 11: 32,372,750 (GRCm39) V639A probably benign Het
Slc39a10 A G 1: 46,851,285 (GRCm39) V735A possibly damaging Het
Slc45a2 T A 15: 11,012,800 (GRCm39) Y268N probably benign Het
Tmco5 A G 2: 116,717,787 (GRCm39) probably null Het
Ulk1 C T 5: 110,937,223 (GRCm39) R691Q probably benign Het
Wwp1 A T 4: 19,631,085 (GRCm39) H649Q probably damaging Het
Other mutations in Or10d1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Or10d1c APN 9 38,893,842 (GRCm39) missense possibly damaging 0.71
R1061:Or10d1c UTSW 9 38,893,779 (GRCm39) missense probably damaging 1.00
R1604:Or10d1c UTSW 9 38,893,914 (GRCm39) missense probably benign 0.01
R1776:Or10d1c UTSW 9 38,894,190 (GRCm39) missense probably damaging 1.00
R3499:Or10d1c UTSW 9 38,893,761 (GRCm39) missense probably damaging 1.00
R3876:Or10d1c UTSW 9 38,894,166 (GRCm39) missense probably damaging 1.00
R4191:Or10d1c UTSW 9 38,894,313 (GRCm39) missense probably benign 0.01
R4192:Or10d1c UTSW 9 38,894,313 (GRCm39) missense probably benign 0.01
R4333:Or10d1c UTSW 9 38,893,884 (GRCm39) missense possibly damaging 0.85
R4876:Or10d1c UTSW 9 38,893,922 (GRCm39) nonsense probably null
R5539:Or10d1c UTSW 9 38,893,573 (GRCm39) missense possibly damaging 0.85
R6916:Or10d1c UTSW 9 38,894,200 (GRCm39) missense probably benign 0.14
R7097:Or10d1c UTSW 9 38,893,914 (GRCm39) missense probably benign 0.01
R7338:Or10d1c UTSW 9 38,893,816 (GRCm39) missense probably damaging 0.99
R8116:Or10d1c UTSW 9 38,894,169 (GRCm39) missense probably damaging 1.00
R9350:Or10d1c UTSW 9 38,894,081 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AATAGGCCCTTGCTGTAGC -3'
(R):5'- ATTGTGGTCCCAATGAAGTGG -3'

Sequencing Primer
(F):5'- TAGGCTATAGATCAAAGGATTCAGC -3'
(R):5'- GTGGTCCCAATGAAGTGGATTATTAC -3'
Posted On 2015-03-18