Incidental Mutation 'R3779:Myl12a'
ID271984
Institutional Source Beutler Lab
Gene Symbol Myl12a
Ensembl Gene ENSMUSG00000024048
Gene Namemyosin, light chain 12A, regulatory, non-sarcomeric
Synonyms2900073G15Rik, brain specific myosin regulatory light chain, NMDA receptor-interacting protein
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R3779 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location70993656-71002878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70994636 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 165 (H165Q)
Ref Sequence ENSEMBL: ENSMUSP00000123412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024846] [ENSMUST00000038446] [ENSMUST00000123686] [ENSMUST00000128179] [ENSMUST00000148960] [ENSMUST00000150456]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024846
AA Change: H165Q

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024846
Gene: ENSMUSG00000024048
AA Change: H165Q

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
EFh 33 61 2.52e-7 SMART
EFh 102 130 6.95e0 SMART
Blast:EFh 138 166 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038446
SMART Domains Protein: ENSMUSP00000042364
Gene: ENSMUSG00000034868

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
EFh 33 61 1.26e-7 SMART
EFh 102 130 1.25e0 SMART
Blast:EFh 138 166 6e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000123686
AA Change: H165Q

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116398
Gene: ENSMUSG00000024048
AA Change: H165Q

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
EFh 33 61 2.52e-7 SMART
EFh 102 130 6.95e0 SMART
Blast:EFh 138 166 6e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126529
Predicted Effect probably benign
Transcript: ENSMUST00000128179
SMART Domains Protein: ENSMUSP00000119491
Gene: ENSMUSG00000024048

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
Pfam:EF-hand_1 33 58 7.7e-9 PFAM
Pfam:EF-hand_6 33 58 7.4e-9 PFAM
Pfam:EF-hand_5 34 58 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131820
Predicted Effect possibly damaging
Transcript: ENSMUST00000148960
AA Change: H165Q

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123412
Gene: ENSMUSG00000024048
AA Change: H165Q

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
EFh 33 61 2.52e-7 SMART
EFh 102 130 6.95e0 SMART
Blast:EFh 138 166 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150456
SMART Domains Protein: ENSMUSP00000114712
Gene: ENSMUSG00000024048

DomainStartEndE-ValueType
Pfam:EF-hand_7 13 78 1.2e-8 PFAM
Pfam:EF-hand_1 33 61 1.7e-9 PFAM
Pfam:EF-hand_6 33 62 1.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activity of nonmuscle myosin II (see MYH9; MIM 160775) is regulated by phosphorylation of a regulatory light chain, such as MRLC2. This phosphorylation results in higher MgATPase activity and the assembly of myosin II filaments (Iwasaki et al., 2001 [PubMed 11942626]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,385 C73R probably damaging Het
Acot10 A G 15: 20,665,542 V371A probably damaging Het
Ambn C A 5: 88,465,342 probably benign Het
Ankrd34a T C 3: 96,598,931 F484L possibly damaging Het
Bcl11a A G 11: 24,164,568 K637R probably damaging Het
Cenpe T C 3: 135,256,576 S1968P possibly damaging Het
Cfap61 T C 2: 145,950,794 I52T probably damaging Het
Cit A T 5: 115,859,341 M128L probably benign Het
Cnga1 G T 5: 72,604,783 L463I probably damaging Het
Dnah11 C T 12: 118,130,713 probably benign Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Ep400 A G 5: 110,691,649 I1853T unknown Het
Flg2 C T 3: 93,202,423 S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm21886 G T 18: 80,089,434 Q170K possibly damaging Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Gm9376 T C 14: 118,267,315 V53A probably benign Het
H2-T3 T C 17: 36,189,682 T90A probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmgcs2 C T 3: 98,299,112 probably benign Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Jak1 G A 4: 101,156,490 H1014Y probably benign Het
Klrb1c T C 6: 128,780,343 D253G probably damaging Het
Lpin1 G A 12: 16,564,568 T404M probably damaging Het
Map3k9 A T 12: 81,743,791 probably benign Het
Olfr768 A G 10: 129,093,296 F226S possibly damaging Het
Pdgfrb T A 18: 61,072,666 S575T probably damaging Het
Phldb2 T C 16: 45,748,755 Y1247C probably damaging Het
Pinlyp T A 7: 24,541,835 T181S probably benign Het
Pkn2 A G 3: 142,793,980 V928A possibly damaging Het
Skint5 C T 4: 113,779,040 probably benign Het
Skiv2l2 A T 13: 112,903,392 probably benign Het
Slc24a1 A G 9: 64,948,297 Y443H unknown Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syncrip A C 9: 88,476,939 D172E probably damaging Het
Tex26 T C 5: 149,445,851 I48T probably damaging Het
Trpm6 A C 19: 18,876,039 I1808L possibly damaging Het
Uba2 T C 7: 34,154,646 probably null Het
Vwa8 T A 14: 79,102,322 probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Wrn T A 8: 33,241,020 R1095W probably damaging Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Myl12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Myl12a APN 17 70996853 missense probably benign 0.00
IGL01949:Myl12a APN 17 70996714 missense probably benign 0.18
IGL02136:Myl12a APN 17 70996856 nonsense probably null
R3405:Myl12a UTSW 17 70994742 missense probably benign 0.00
R3406:Myl12a UTSW 17 70994742 missense probably benign 0.00
R3777:Myl12a UTSW 17 70994636 missense possibly damaging 0.93
R4757:Myl12a UTSW 17 70996803 missense possibly damaging 0.86
R4798:Myl12a UTSW 17 70996302 intron probably benign
R5086:Myl12a UTSW 17 70994616 missense possibly damaging 0.70
R5419:Myl12a UTSW 17 70994699 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGACAGAAGGTCCCATTTCCAG -3'
(R):5'- ACAGGCTGTGAAGTTGAGTG -3'

Sequencing Primer
(F):5'- CCAGTATTATAAGGTACATGTGGCCC -3'
(R):5'- AGTGTGGGTTCTCTGACCCTC -3'
Posted On2015-03-25