Incidental Mutation 'R3779:Olfr768'
ID271970
Institutional Source Beutler Lab
Gene Symbol Olfr768
Ensembl Gene ENSMUSG00000050198
Gene Nameolfactory receptor 768
SynonymsGA_x6K02T2PULF-10779441-10778503, MOR114-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3779 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129090222-129099375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129093296 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 226 (F226S)
Ref Sequence ENSEMBL: ENSMUSP00000089619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063031]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063031
AA Change: F226S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089619
Gene: ENSMUSG00000050198
AA Change: F226S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.7e-50 PFAM
Pfam:7tm_1 39 288 5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216681
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,385 C73R probably damaging Het
Acot10 A G 15: 20,665,542 V371A probably damaging Het
Ambn C A 5: 88,465,342 probably benign Het
Ankrd34a T C 3: 96,598,931 F484L possibly damaging Het
Bcl11a A G 11: 24,164,568 K637R probably damaging Het
Cenpe T C 3: 135,256,576 S1968P possibly damaging Het
Cfap61 T C 2: 145,950,794 I52T probably damaging Het
Cit A T 5: 115,859,341 M128L probably benign Het
Cnga1 G T 5: 72,604,783 L463I probably damaging Het
Dnah11 C T 12: 118,130,713 probably benign Het
Elovl4 ACT A 9: 83,785,148 probably null Het
Ep400 A G 5: 110,691,649 I1853T unknown Het
Flg2 C T 3: 93,202,423 S586L unknown Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm21886 G T 18: 80,089,434 Q170K possibly damaging Het
Gm5819 A G 18: 8,694,429 E118G probably damaging Het
Gm9376 T C 14: 118,267,315 V53A probably benign Het
H2-T3 T C 17: 36,189,682 T90A probably damaging Het
Hif1an A G 19: 44,569,408 D243G probably damaging Het
Hmgcs2 C T 3: 98,299,112 probably benign Het
Ighv1-72 A T 12: 115,758,016 S107T probably damaging Het
Jak1 G A 4: 101,156,490 H1014Y probably benign Het
Klrb1c T C 6: 128,780,343 D253G probably damaging Het
Lpin1 G A 12: 16,564,568 T404M probably damaging Het
Map3k9 A T 12: 81,743,791 probably benign Het
Myl12a G T 17: 70,994,636 H165Q possibly damaging Het
Pdgfrb T A 18: 61,072,666 S575T probably damaging Het
Phldb2 T C 16: 45,748,755 Y1247C probably damaging Het
Pinlyp T A 7: 24,541,835 T181S probably benign Het
Pkn2 A G 3: 142,793,980 V928A possibly damaging Het
Skint5 C T 4: 113,779,040 probably benign Het
Skiv2l2 A T 13: 112,903,392 probably benign Het
Slc24a1 A G 9: 64,948,297 Y443H unknown Het
Sp8 G T 12: 118,849,015 V202L possibly damaging Het
Svil A G 18: 5,090,855 N915S probably damaging Het
Syncrip A C 9: 88,476,939 D172E probably damaging Het
Tex26 T C 5: 149,445,851 I48T probably damaging Het
Trpm6 A C 19: 18,876,039 I1808L possibly damaging Het
Uba2 T C 7: 34,154,646 probably null Het
Vwa8 T A 14: 79,102,322 probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Wrn T A 8: 33,241,020 R1095W probably damaging Het
Zfp808 T A 13: 62,171,903 N315K probably damaging Het
Other mutations in Olfr768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Olfr768 APN 10 129093396 missense probably benign 0.08
IGL01947:Olfr768 APN 10 129093878 missense possibly damaging 0.52
IGL03026:Olfr768 APN 10 129093188 missense possibly damaging 0.60
R1353:Olfr768 UTSW 10 129093864 missense probably benign 0.14
R1426:Olfr768 UTSW 10 129093690 missense probably damaging 1.00
R1766:Olfr768 UTSW 10 129093747 missense probably benign 0.24
R2356:Olfr768 UTSW 10 129093892 missense probably benign 0.40
R3522:Olfr768 UTSW 10 129093842 missense possibly damaging 0.93
R3751:Olfr768 UTSW 10 129093306 missense probably damaging 1.00
R4582:Olfr768 UTSW 10 129093158 missense possibly damaging 0.93
R4772:Olfr768 UTSW 10 129093668 missense possibly damaging 0.92
R4792:Olfr768 UTSW 10 129093620 missense probably damaging 1.00
R5749:Olfr768 UTSW 10 129093097 missense probably damaging 0.98
R6571:Olfr768 UTSW 10 129093121 missense probably damaging 0.98
R6619:Olfr768 UTSW 10 129093454 missense possibly damaging 0.95
R7052:Olfr768 UTSW 10 129093875 missense probably damaging 0.98
R7096:Olfr768 UTSW 10 129093846 missense probably damaging 0.97
R7409:Olfr768 UTSW 10 129093212 missense probably damaging 1.00
R7852:Olfr768 UTSW 10 129093516 missense probably benign 0.45
R7935:Olfr768 UTSW 10 129093516 missense probably benign 0.45
X0024:Olfr768 UTSW 10 129093115 missense possibly damaging 0.95
X0024:Olfr768 UTSW 10 129093347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGAGCAACCGAAGTC -3'
(R):5'- GCATCCAGTTCCTTATTGGCTG -3'

Sequencing Primer
(F):5'- CCGAAGTCGTGAGCACAGAC -3'
(R):5'- TGTCATCCCACCTTATAGCATAAG -3'
Posted On2015-03-25