Incidental Mutation 'R3782:Olfr385'
ID272090
Institutional Source Beutler Lab
Gene Symbol Olfr385
Ensembl Gene ENSMUSG00000095095
Gene Nameolfactory receptor 385
SynonymsMOR135-3, GA_x6K02T2P1NL-3760313-3759375
MMRRC Submission 040751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R3782 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73588302-73593008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73589013 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 242 (G242C)
Ref Sequence ENSEMBL: ENSMUSP00000149293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071553] [ENSMUST00000215689]
Predicted Effect probably damaging
Transcript: ENSMUST00000071553
AA Change: G242C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071484
Gene: ENSMUSG00000095095
AA Change: G242C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.1e-55 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.7e-6 PFAM
Pfam:7tm_1 41 290 2.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215689
AA Change: G242C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aimp2 T A 5: 143,906,699 K24N possibly damaging Het
Atf6 A T 1: 170,794,767 Y428* probably null Het
BC034090 T C 1: 155,226,278 E80G probably damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cpsf3 A C 12: 21,300,066 E262A possibly damaging Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dlg5 A G 14: 24,190,310 probably benign Het
Enam A T 5: 88,502,815 S653C probably damaging Het
Fndc3b A T 3: 27,459,986 V682D possibly damaging Het
Gm7075 T A 10: 63,421,693 H16L probably benign Het
Guf1 A T 5: 69,567,152 M396L probably benign Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpgd G A 8: 56,298,418 V94M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama5 T G 2: 180,194,563 H1165P possibly damaging Het
Lrrfip1 A G 1: 91,112,189 T205A possibly damaging Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Mpp7 A T 18: 7,351,085 H537Q probably damaging Het
Mx1 T C 16: 97,451,995 D380G possibly damaging Het
Nckap5 T A 1: 126,025,074 Q1183L possibly damaging Het
Nkx1-2 A G 7: 132,597,432 V200A probably damaging Het
Nr3c2 T A 8: 77,085,684 probably null Het
Nsmce1 C T 7: 125,486,377 V47I probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1009 G A 2: 85,721,696 C97Y probably damaging Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Phactr4 A T 4: 132,367,867 probably null Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Spta1 A T 1: 174,208,314 Y1062F probably damaging Het
Ssc5d A G 7: 4,942,791 T941A probably benign Het
Taf11 A G 17: 27,903,193 probably benign Het
Tax1bp1 A G 6: 52,739,548 H286R probably damaging Het
Tmem62 T A 2: 120,977,467 W57R probably damaging Het
Vmn2r111 T C 17: 22,571,320 Y235C possibly damaging Het
Vmn2r22 T A 6: 123,650,632 K2* probably null Het
Vmn2r74 A G 7: 85,956,114 V442A probably benign Het
Other mutations in Olfr385
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01570:Olfr385 APN 11 73589383 missense probably benign 0.34
IGL02045:Olfr385 APN 11 73589232 missense probably damaging 1.00
IGL02324:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02328:Olfr385 APN 11 73589255 missense probably benign 0.02
IGL02562:Olfr385 APN 11 73589411 missense probably benign
IGL02715:Olfr385 APN 11 73589121 missense probably benign 0.00
IGL03182:Olfr385 APN 11 73589442 missense probably benign 0.04
IGL03048:Olfr385 UTSW 11 73589005 missense possibly damaging 0.56
R0346:Olfr385 UTSW 11 73589457 missense probably damaging 1.00
R0675:Olfr385 UTSW 11 73589252 missense probably damaging 1.00
R0751:Olfr385 UTSW 11 73589144 missense probably benign 0.02
R1220:Olfr385 UTSW 11 73589377 nonsense probably null
R1389:Olfr385 UTSW 11 73589543 missense possibly damaging 0.88
R1484:Olfr385 UTSW 11 73589361 missense possibly damaging 0.91
R1619:Olfr385 UTSW 11 73589292 missense probably damaging 1.00
R2290:Olfr385 UTSW 11 73588919 missense probably benign 0.37
R3713:Olfr385 UTSW 11 73588905 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589013 missense probably damaging 1.00
R3781:Olfr385 UTSW 11 73589368 nonsense probably null
R3782:Olfr385 UTSW 11 73589368 nonsense probably null
R4402:Olfr385 UTSW 11 73589255 missense probably benign 0.02
R4721:Olfr385 UTSW 11 73589447 missense probably damaging 1.00
R5157:Olfr385 UTSW 11 73589723 missense probably damaging 1.00
R5995:Olfr385 UTSW 11 73589250 missense probably benign
R6373:Olfr385 UTSW 11 73588898 missense probably benign 0.42
R6658:Olfr385 UTSW 11 73589048 missense probably damaging 0.99
R7046:Olfr385 UTSW 11 73589732 missense probably benign
R7096:Olfr385 UTSW 11 73589637 missense probably benign 0.03
R7238:Olfr385 UTSW 11 73589735 start codon destroyed probably null 0.99
R7537:Olfr385 UTSW 11 73589268 missense probably benign 0.04
R7548:Olfr385 UTSW 11 73588976 missense possibly damaging 0.56
R7888:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
R7971:Olfr385 UTSW 11 73589528 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACTCTAATCAGGGCCTCTTTC -3'
(R):5'- TGTGAGGACAATGTGATCCCC -3'

Sequencing Primer
(F):5'- CATATCTTTGTTCCTCAGGCTGTAG -3'
(R):5'- GACATATCTGCCGTTCTCAAGTTGG -3'
Posted On2015-03-25