Incidental Mutation 'R3782:Atf6'
ID 272066
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Name activating transcription factor 6
Synonyms 9130025P16Rik, ESTM49, Atf6alpha
MMRRC Submission 040751-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R3782 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 170704674-170867771 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 170794767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 428 (Y428*)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably null
Transcript: ENSMUST00000027974
AA Change: Y428*
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: Y428*

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182787
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aimp2 T A 5: 143,906,699 K24N possibly damaging Het
BC034090 T C 1: 155,226,278 E80G probably damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cpsf3 A C 12: 21,300,066 E262A possibly damaging Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dlg5 A G 14: 24,190,310 probably benign Het
Enam A T 5: 88,502,815 S653C probably damaging Het
Fndc3b A T 3: 27,459,986 V682D possibly damaging Het
Gm7075 T A 10: 63,421,693 H16L probably benign Het
Guf1 A T 5: 69,567,152 M396L probably benign Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpgd G A 8: 56,298,418 V94M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama5 T G 2: 180,194,563 H1165P possibly damaging Het
Lrrfip1 A G 1: 91,112,189 T205A possibly damaging Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Mpp7 A T 18: 7,351,085 H537Q probably damaging Het
Mx1 T C 16: 97,451,995 D380G possibly damaging Het
Nckap5 T A 1: 126,025,074 Q1183L possibly damaging Het
Nkx1-2 A G 7: 132,597,432 V200A probably damaging Het
Nr3c2 T A 8: 77,085,684 probably null Het
Nsmce1 C T 7: 125,486,377 V47I probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1009 G A 2: 85,721,696 C97Y probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Phactr4 A T 4: 132,367,867 probably null Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Spta1 A T 1: 174,208,314 Y1062F probably damaging Het
Ssc5d A G 7: 4,942,791 T941A probably benign Het
Taf11 A G 17: 27,903,193 probably benign Het
Tax1bp1 A G 6: 52,739,548 H286R probably damaging Het
Tmem62 T A 2: 120,977,467 W57R probably damaging Het
Vmn2r111 T C 17: 22,571,320 Y235C possibly damaging Het
Vmn2r22 T A 6: 123,650,632 K2* probably null Het
Vmn2r74 A G 7: 85,956,114 V442A probably benign Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170788606 critical splice donor site probably null
IGL01431:Atf6 APN 1 170853002 splice site probably benign
IGL01755:Atf6 APN 1 170788611 missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170819420 missense probably damaging 0.99
IGL02416:Atf6 APN 1 170747157 nonsense probably null
IGL02903:Atf6 APN 1 170799714 missense probably benign 0.00
IGL02989:Atf6 APN 1 170788683 splice site probably benign
IGL03209:Atf6 APN 1 170834894 missense probably benign
R0455:Atf6 UTSW 1 170834923 missense probably benign 0.00
R0467:Atf6 UTSW 1 170794020 missense probably damaging 1.00
R0491:Atf6 UTSW 1 170787344 critical splice donor site probably null
R0784:Atf6 UTSW 1 170709947 missense probably benign 0.19
R1486:Atf6 UTSW 1 170794691 missense probably damaging 1.00
R1850:Atf6 UTSW 1 170819286 missense probably damaging 1.00
R1945:Atf6 UTSW 1 170855141 missense probably benign 0.00
R2164:Atf6 UTSW 1 170794735 missense probably damaging 1.00
R4454:Atf6 UTSW 1 170794039 missense probably damaging 0.99
R4631:Atf6 UTSW 1 170747197 splice site probably null
R4676:Atf6 UTSW 1 170787410 missense probably damaging 1.00
R5772:Atf6 UTSW 1 170747189 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841775 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841776 missense possibly damaging 0.95
R5950:Atf6 UTSW 1 170834879 missense probably damaging 1.00
R6242:Atf6 UTSW 1 170793976 missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170867669 missense probably benign 0.00
R7032:Atf6 UTSW 1 170799612 critical splice donor site probably null
R7472:Atf6 UTSW 1 170815491 missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170794706 missense probably benign
R8002:Atf6 UTSW 1 170819254 missense probably benign 0.43
R8860:Atf6 UTSW 1 170852966 missense probably null 0.95
R8956:Atf6 UTSW 1 170794007 missense probably damaging 0.98
R9090:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9271:Atf6 UTSW 1 170794676 missense probably damaging 1.00
R9323:Atf6 UTSW 1 170855113 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCTCTTACTAAAGCTGAAG -3'
(R):5'- ACTCTGCCAGCTCTTAGAAAC -3'

Sequencing Primer
(F):5'- GGCCTCTTACTAAAGCTGAAGAAATG -3'
(R):5'- TCTGCCAGCTCTTAGAAACTGAGAG -3'
Posted On 2015-03-25