Mutagenetix > Incidental Mutation

Incidental Mutation 'R3782:Atf6'

272066

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

040751-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R3782 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 170794767 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 428 (Y428*)

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

probably null
Transcript: ENSMUST00000027974
AA Change: Y428*

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: Y428*

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182787

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aimp2	T	A	5: 143,906,699	K24N	possibly damaging	Het
BC034090	T	C	1: 155,226,278	E80G	probably damaging	Het
Calcr	T	C	6: 3,700,193	T263A	possibly damaging	Het
Cdh7	T	A	1: 110,049,004	V133E	probably benign	Het
Cpsf3	A	C	12: 21,300,066	E262A	possibly damaging	Het
Ddx5	T	C	11: 106,784,520	I330V	probably benign	Het
Dlg5	A	G	14: 24,190,310		probably benign	Het
Enam	A	T	5: 88,502,815	S653C	probably damaging	Het
Fndc3b	A	T	3: 27,459,986	V682D	possibly damaging	Het
Gm7075	T	A	10: 63,421,693	H16L	probably benign	Het
Guf1	A	T	5: 69,567,152	M396L	probably benign	Het
H2-Q10	A	G	17: 35,471,018	Y179C	possibly damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Hpgd	G	A	8: 56,298,418	V94M	probably damaging	Het
Ktn1	G	A	14: 47,706,403		probably benign	Het
Lama5	T	G	2: 180,194,563	H1165P	possibly damaging	Het
Lrrfip1	A	G	1: 91,112,189	T205A	possibly damaging	Het
Mcm7	G	A	5: 138,164,736	R385W	probably damaging	Het
Mgat4c	A	G	10: 102,388,921	E332G	probably benign	Het
Mpp7	A	T	18: 7,351,085	H537Q	probably damaging	Het
Mx1	T	C	16: 97,451,995	D380G	possibly damaging	Het
Nckap5	T	A	1: 126,025,074	Q1183L	possibly damaging	Het
Nkx1-2	A	G	7: 132,597,432	V200A	probably damaging	Het
Nr3c2	T	A	8: 77,085,684		probably null	Het
Nsmce1	C	T	7: 125,486,377	V47I	probably benign	Het
Nudt3	A	G	17: 27,580,808	S134P	possibly damaging	Het
Olfr1009	G	A	2: 85,721,696	C97Y	probably damaging	Het
Olfr385	C	A	11: 73,589,013	G242C	probably damaging	Het
Olfr385	A	T	11: 73,589,368	Y123*	probably null	Het
Pcnx	A	G	12: 81,996,118	T2325A	probably benign	Het
Phactr4	A	T	4: 132,367,867		probably null	Het
Serpinb6d	T	A	13: 33,664,114	D20E	probably benign	Het
Spta1	A	T	1: 174,208,314	Y1062F	probably damaging	Het
Ssc5d	A	G	7: 4,942,791	T941A	probably benign	Het
Taf11	A	G	17: 27,903,193		probably benign	Het
Tax1bp1	A	G	6: 52,739,548	H286R	probably damaging	Het
Tmem62	T	A	2: 120,977,467	W57R	probably damaging	Het
Vmn2r111	T	C	17: 22,571,320	Y235C	possibly damaging	Het
Vmn2r22	T	A	6: 123,650,632	K2*	probably null	Het
Vmn2r74	A	G	7: 85,956,114	V442A	probably benign	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0467:Atf6	UTSW	1	170794020	missense	probably damaging	1.00
R0491:Atf6	UTSW	1	170787344	critical splice donor site	probably null
R0784:Atf6	UTSW	1	170709947	missense	probably benign	0.19
R1486:Atf6	UTSW	1	170794691	missense	probably damaging	1.00
R1850:Atf6	UTSW	1	170819286	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R2164:Atf6	UTSW	1	170794735	missense	probably damaging	1.00
R4454:Atf6	UTSW	1	170794039	missense	probably damaging	0.99
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841776	missense	possibly damaging	0.95
R5950:Atf6	UTSW	1	170834879	missense	probably damaging	1.00
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGCCTCTTACTAAAGCTGAAG -3'
(R):5'- ACTCTGCCAGCTCTTAGAAAC -3'

Sequencing Primer
(F):5'- GGCCTCTTACTAAAGCTGAAGAAATG -3'
(R):5'- TCTGCCAGCTCTTAGAAACTGAGAG -3'

Posted On

2015-03-25