Incidental Mutation 'R3802:Pak3'
ID274386
Institutional Source Beutler Lab
Gene Symbol Pak3
Ensembl Gene ENSMUSG00000031284
Gene Namep21 (RAC1) activated kinase 3
SynonymsPAK-3
MMRRC Submission 040761-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R3802 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location143518591-143797796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143709731 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 87 (V87I)
Ref Sequence ENSEMBL: ENSMUSP00000118716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033640] [ENSMUST00000112863] [ENSMUST00000112864] [ENSMUST00000112865] [ENSMUST00000112868] [ENSMUST00000134402] [ENSMUST00000155215] [ENSMUST00000156449] [ENSMUST00000172330]
Predicted Effect probably benign
Transcript: ENSMUST00000033640
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033640
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112863
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108484
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112864
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108485
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112865
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108486
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112868
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108489
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134402
AA Change: V87I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119090
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 2.49e-9 SMART
Pfam:PBD 124 163 2e-9 PFAM
low complexity region 208 225 N/A INTRINSIC
Pfam:Pkinase 304 366 4e-10 PFAM
Pfam:Pkinase_Tyr 304 366 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155215
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118549
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156449
AA Change: V87I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118716
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172330
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126562
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Meta Mutation Damage Score 0.1486 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase and forms an activated complex with GTP-bound RAS-like (P21), CDC2 and RAC1. This protein may be necessary for dendritic development and for the rapid cytoskeletal reorganization in dendritic spines associated with synaptic plasticity. Defects in this gene are the cause of non-syndromic mental retardation X-linked type 30 (MRX30), also called X-linked mental retardation type 47 (MRX47). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for one knock-out allele display a selective impairment in hippocampal late-phase long-term potentiation, and deficits in learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,510,931 D494E probably benign Het
9230104L09Rik T C 2: 148,850,696 H62R probably benign Het
Abcc2 C A 19: 43,821,626 N874K probably benign Het
Axl A T 7: 25,788,477 M1K probably null Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc105 A C 10: 78,748,480 F367C probably damaging Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cfap58 G T 19: 47,953,059 D289Y possibly damaging Het
Cnn2 A G 10: 79,993,495 D153G probably benign Het
Cubn T C 2: 13,360,353 I1625V probably benign Het
Gm13178 A T 4: 144,703,504 L305Q possibly damaging Het
Gprc5b C T 7: 118,983,720 D309N possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Hhipl1 A G 12: 108,312,307 E298G probably benign Het
Hivep2 A G 10: 14,148,961 D2173G possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Kpnb1 A T 11: 97,166,129 V638E possibly damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Mga T A 2: 119,947,339 N1788K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 A G 7: 64,320,628 Y373C probably benign Het
Ncoa6 C T 2: 155,405,564 G1940D probably benign Het
Nelfe T A 17: 34,853,901 F166L possibly damaging Het
Nfatc3 A G 8: 106,079,645 Y374C probably damaging Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Olfr583 A G 7: 103,052,165 Y289C probably benign Het
Olfr952 G A 9: 39,426,286 P262S probably damaging Het
Papolg A T 11: 23,876,449 I235N probably damaging Het
Pdgfrl T C 8: 40,985,557 S177P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Sgk1 T C 10: 21,997,412 V259A probably damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Tas2r106 C A 6: 131,678,366 S174I probably benign Het
Tsn A T 1: 118,305,296 F93I probably damaging Het
Vav2 T C 2: 27,267,223 probably benign Het
Vmn2r63 A T 7: 42,903,405 M809K probably damaging Het
Zfp260 G A 7: 30,105,079 E135K probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Pak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Pak3 APN X 143789333 missense probably damaging 1.00
R0464:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0583:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0586:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0587:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0781:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0908:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R1029:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R1917:Pak3 UTSW X 143791302 missense possibly damaging 0.94
R2918:Pak3 UTSW X 143764976 missense probably damaging 1.00
R3801:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3803:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3804:Pak3 UTSW X 143709731 missense probably damaging 1.00
R4326:Pak3 UTSW X 143733209 splice site probably null
R4328:Pak3 UTSW X 143733209 splice site probably null
R4329:Pak3 UTSW X 143733209 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTCCATGTACTTGTCAGTAAGG -3'
(R):5'- GGCAGGGTCTCCTTAGCATAAC -3'

Sequencing Primer
(F):5'- TGTACATACCAGAAAACGATGAGTC -3'
(R):5'- AGCATAACTACATTTTCTGTGCC -3'
Posted On2015-04-02