Incidental Mutation 'R3804:Pak3'
ID274532
Institutional Source Beutler Lab
Gene Symbol Pak3
Ensembl Gene ENSMUSG00000031284
Gene Namep21 (RAC1) activated kinase 3
SynonymsPAK-3
MMRRC Submission 040879-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R3804 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location143518591-143797796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143709731 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 87 (V87I)
Ref Sequence ENSEMBL: ENSMUSP00000118716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033640] [ENSMUST00000112863] [ENSMUST00000112864] [ENSMUST00000112865] [ENSMUST00000112868] [ENSMUST00000134402] [ENSMUST00000155215] [ENSMUST00000156449] [ENSMUST00000172330]
Predicted Effect probably benign
Transcript: ENSMUST00000033640
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033640
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112863
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108484
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 204 N/A INTRINSIC
S_TKc 283 534 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112864
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108485
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112865
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108486
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112868
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108489
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134402
AA Change: V87I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119090
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 2.49e-9 SMART
Pfam:PBD 124 163 2e-9 PFAM
low complexity region 208 225 N/A INTRINSIC
Pfam:Pkinase 304 366 4e-10 PFAM
Pfam:Pkinase_Tyr 304 366 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155215
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118549
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 120 6.48e-8 SMART
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156449
AA Change: V87I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118716
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172330
AA Change: V87I

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126562
Gene: ENSMUSG00000031284
AA Change: V87I

DomainStartEndE-ValueType
PBD 70 105 1.11e-15 SMART
low complexity region 172 189 N/A INTRINSIC
S_TKc 268 519 1.46e-98 SMART
Meta Mutation Damage Score 0.1486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase and forms an activated complex with GTP-bound RAS-like (P21), CDC2 and RAC1. This protein may be necessary for dendritic development and for the rapid cytoskeletal reorganization in dendritic spines associated with synaptic plasticity. Defects in this gene are the cause of non-syndromic mental retardation X-linked type 30 (MRX30), also called X-linked mental retardation type 47 (MRX47). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for one knock-out allele display a selective impairment in hippocampal late-phase long-term potentiation, and deficits in learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik C T 8: 79,248,293 E54K probably benign Het
2610301B20Rik A G 4: 10,898,014 T199A probably benign Het
Adgra1 A G 7: 139,845,594 T8A probably benign Het
Alms1 A G 6: 85,619,647 Y954C probably damaging Het
AU021092 A C 16: 5,216,762 F199V possibly damaging Het
Bahcc1 C T 11: 120,283,358 P1648L probably benign Het
Cacna1s T A 1: 136,107,018 C1319S possibly damaging Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cntn5 A G 9: 9,781,663 probably benign Het
Cyth4 A G 15: 78,609,802 K159E probably damaging Het
Dgkz C A 2: 91,939,630 R563L probably benign Het
Dnah8 A G 17: 30,670,647 E718G probably benign Het
Dopey1 T C 9: 86,520,995 L1416P probably damaging Het
Dstyk G A 1: 132,449,726 A110T probably damaging Het
Eif1 A G 11: 100,320,824 K95E probably damaging Het
Espnl A G 1: 91,322,221 D30G probably benign Het
Gast T C 11: 100,336,810 S73P probably damaging Het
Gmppb T C 9: 108,050,574 Y176H probably damaging Het
Grap2 A G 15: 80,623,746 T4A possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
Gtf3c3 A G 1: 54,424,007 probably null Het
Hmcn2 A G 2: 31,352,885 probably null Het
Icam2 A G 11: 106,380,822 L94P probably damaging Het
Iqcm C A 8: 75,669,393 T188K possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Lgr4 A G 2: 110,008,197 K498E probably benign Het
Meltf A G 16: 31,884,998 H181R probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nf1 A G 11: 79,559,521 D511G probably null Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Nrap C T 19: 56,321,779 D1595N probably damaging Het
Olfr1 T C 11: 73,395,950 Q24R probably benign Het
Olfr430 T A 1: 174,069,908 N203K probably damaging Het
Olfr481 A T 7: 108,081,171 I126F probably damaging Het
Olfr805 T A 10: 129,723,049 D165V possibly damaging Het
Pgm2l1 T C 7: 100,252,267 V121A probably benign Het
Phf19 A G 2: 34,899,658 L350P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Phkb G T 8: 85,922,229 E225* probably null Het
Pif1 T A 9: 65,588,306 V166E probably damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Prpf4b T C 13: 34,883,682 probably benign Het
Rxra T C 2: 27,756,260 C374R probably damaging Het
Sept3 T C 15: 82,286,429 probably benign Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Slc22a15 C T 3: 101,897,274 G145D probably damaging Het
Slc28a1 A T 7: 81,126,221 I222F probably damaging Het
Slc43a2 T C 11: 75,563,598 L323P probably benign Het
Sorbs3 A G 14: 70,199,351 probably benign Het
Spink10 C T 18: 62,653,414 probably benign Het
Suclg2 A T 6: 95,497,668 I372N probably damaging Het
Sun1 C A 5: 139,225,362 C164* probably null Het
Tax1bp1 T C 6: 52,742,785 F453L probably benign Het
Tmem54 A G 4: 129,108,220 N9S probably benign Het
Tmx4 A G 2: 134,620,577 W145R probably damaging Het
Top1 A G 2: 160,702,768 H268R probably damaging Het
Ttn A G 2: 76,810,731 L13598P probably damaging Het
Vmn1r40 A G 6: 89,715,009 I269M probably benign Het
Wdr7 G T 18: 63,720,836 R80L probably benign Het
Zap70 A T 1: 36,771,142 Q111L possibly damaging Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Pak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Pak3 APN X 143789333 missense probably damaging 1.00
R0464:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0583:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0586:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0587:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0781:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R0908:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R1029:Pak3 UTSW X 143743893 critical splice acceptor site probably benign
R1917:Pak3 UTSW X 143791302 missense possibly damaging 0.94
R2918:Pak3 UTSW X 143764976 missense probably damaging 1.00
R3801:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3802:Pak3 UTSW X 143709731 missense probably damaging 1.00
R3803:Pak3 UTSW X 143709731 missense probably damaging 1.00
R4326:Pak3 UTSW X 143733209 splice site probably null
R4328:Pak3 UTSW X 143733209 splice site probably null
R4329:Pak3 UTSW X 143733209 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTCCATGTACTTGTCAGTAAGG -3'
(R):5'- TTCAGGCAGGGTCTCCTTAG -3'

Sequencing Primer
(F):5'- TGTACATACCAGAAAACGATGAGTC -3'
(R):5'- GGCAGGGTCTCCTTAGCATAACTAC -3'
Posted On2015-04-02