Incidental Mutation 'R3862:Zfand4'
ID276394
Institutional Source Beutler Lab
Gene Symbol Zfand4
Ensembl Gene ENSMUSG00000042213
Gene Namezinc finger, AN1-type domain 4
SynonymsAnubl1, 2810002D23Rik
MMRRC Submission 040903-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3862 (G1)
Quality Score195
Status Validated
Chromosome6
Chromosomal Location116264222-116330302 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 116293815 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036503] [ENSMUST00000112900] [ENSMUST00000220845] [ENSMUST00000221069] [ENSMUST00000222494] [ENSMUST00000222819] [ENSMUST00000223495]
Predicted Effect probably benign
Transcript: ENSMUST00000036503
SMART Domains Protein: ENSMUSP00000040057
Gene: ENSMUSG00000042213

DomainStartEndE-ValueType
low complexity region 118 151 N/A INTRINSIC
low complexity region 458 472 N/A INTRINSIC
ZnF_AN1 554 592 4.18e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112900
SMART Domains Protein: ENSMUSP00000108521
Gene: ENSMUSG00000042213

DomainStartEndE-ValueType
UBQ 54 125 4.11e-15 SMART
low complexity region 262 295 N/A INTRINSIC
low complexity region 602 616 N/A INTRINSIC
ZnF_AN1 698 736 4.18e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220845
Predicted Effect probably benign
Transcript: ENSMUST00000221069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222144
Predicted Effect probably benign
Transcript: ENSMUST00000222494
Predicted Effect probably benign
Transcript: ENSMUST00000222819
Predicted Effect probably benign
Transcript: ENSMUST00000223495
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,885,398 F134I possibly damaging Het
Apc2 G A 10: 80,307,559 G498R possibly damaging Het
Bub1 A G 2: 127,814,756 probably benign Het
Cttnbp2 C T 6: 18,434,906 V318M probably benign Het
D430041D05Rik T C 2: 104,214,177 I825M possibly damaging Het
Enpp6 A G 8: 47,065,992 Q265R probably benign Het
Eri1 A G 8: 35,491,294 V61A possibly damaging Het
Evi2 T A 11: 79,515,646 I368F probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fkbp9 A G 6: 56,868,905 T409A probably benign Het
Gm597 T C 1: 28,777,641 T437A probably damaging Het
Gtpbp4 A G 13: 8,990,798 V97A probably damaging Het
Hapln1 C T 13: 89,605,299 Q195* probably null Het
Helt G T 8: 46,292,278 N189K probably benign Het
Hint2 A G 4: 43,654,771 V91A probably damaging Het
Ighv1-7 A G 12: 114,538,646 I67T probably damaging Het
Kif26a A G 12: 112,179,889 E1803G probably benign Het
Lrrd1 G A 5: 3,851,248 V518I probably benign Het
March11 C T 15: 26,387,866 A269V probably damaging Het
Mep1b A G 18: 21,084,169 N115S possibly damaging Het
Naif1 A G 2: 32,452,625 R63G probably damaging Het
Nsmaf A G 4: 6,435,064 I126T probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr652 G A 7: 104,564,938 R239H probably benign Het
Olfr968 T A 9: 39,772,624 M59L probably benign Het
Pcdhb3 A G 18: 37,303,276 E765G probably damaging Het
Ppp4r4 C T 12: 103,596,421 R550* probably null Het
Scgb2b3 C T 7: 31,362,005 probably null Het
Sgcz T C 8: 37,523,411 I263V probably benign Het
Slc15a1 C T 14: 121,484,857 V211I probably benign Het
Slc25a21 G T 12: 56,718,135 probably benign Het
Snrnp200 C A 2: 127,233,099 probably benign Het
Sptbn1 G T 11: 30,142,329 Q479K possibly damaging Het
Stag1 T A 9: 100,944,785 V935D probably benign Het
Veph1 C T 3: 66,254,892 C115Y probably damaging Het
Zc3h12a T C 4: 125,126,939 D37G probably benign Het
Other mutations in Zfand4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Zfand4 APN 6 116314869 missense probably benign 0.14
IGL02001:Zfand4 APN 6 116273652 missense probably benign 0.11
IGL02047:Zfand4 APN 6 116314928 missense probably damaging 1.00
IGL02887:Zfand4 APN 6 116273656 missense possibly damaging 0.66
IGL02943:Zfand4 APN 6 116273876 splice site probably benign
IGL03058:Zfand4 APN 6 116288077 missense probably benign 0.03
IGL03130:Zfand4 APN 6 116273659 missense probably damaging 0.99
IGL03253:Zfand4 APN 6 116284809 missense probably damaging 1.00
PIT4802001:Zfand4 UTSW 6 116284775 missense probably damaging 1.00
R0015:Zfand4 UTSW 6 116328297 missense probably damaging 1.00
R0133:Zfand4 UTSW 6 116314739 missense probably benign 0.02
R0446:Zfand4 UTSW 6 116288054 missense probably benign 0.29
R0508:Zfand4 UTSW 6 116285867 missense probably damaging 1.00
R1385:Zfand4 UTSW 6 116273638 missense probably damaging 1.00
R1577:Zfand4 UTSW 6 116329412 nonsense probably null
R2179:Zfand4 UTSW 6 116314781 missense possibly damaging 0.92
R4607:Zfand4 UTSW 6 116328234 nonsense probably null
R4608:Zfand4 UTSW 6 116328234 nonsense probably null
R4720:Zfand4 UTSW 6 116288161 critical splice donor site probably null
R4724:Zfand4 UTSW 6 116273819 missense probably damaging 1.00
R4771:Zfand4 UTSW 6 116314350 missense probably damaging 1.00
R5541:Zfand4 UTSW 6 116314295 missense possibly damaging 0.50
R5721:Zfand4 UTSW 6 116287995 missense probably damaging 1.00
R5901:Zfand4 UTSW 6 116288123 missense probably damaging 0.99
R6253:Zfand4 UTSW 6 116273614 missense probably damaging 0.97
R6798:Zfand4 UTSW 6 116328253 missense probably benign 0.01
R7030:Zfand4 UTSW 6 116305657 missense probably benign 0.01
R7081:Zfand4 UTSW 6 116315620 missense possibly damaging 0.71
R7082:Zfand4 UTSW 6 116328376 intron probably null
Predicted Primers PCR Primer
(F):5'- ATAGTCTGTTCCCGGATATTCGC -3'
(R):5'- GTATCAAAAGATGGCCTAGTCGG -3'

Sequencing Primer
(F):5'- AAGCAGTGGCCTCATATGTC -3'
(R):5'- CTAGTCGGCCATCACTGGAAAG -3'
Posted On2015-04-06