Mutagenetix > Incidental Mutation

Incidental Mutation 'R3862:Sptbn1'

276405

Institutional Source

Beutler Lab

Gene Symbol

Sptbn1

Ensembl Gene

ENSMUSG00000020315

Gene Name

spectrin beta, non-erythrocytic 1

Synonyms

beta fodrin, Spnb-2, 9930031C03Rik, spectrin G, elf1, brain spectrin, elf3, Spnb2, non-erythrocytic

MMRRC Submission

040903-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3862 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30049395-30218175 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 30092329 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 479 (Q479K)

Ref Sequence

ENSEMBL: ENSMUSP00000011877 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]

AlphaFold

Q62261

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006629
AA Change: Q479K

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: Q479K

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000011877
AA Change: Q479K

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: Q479K

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102838
AA Change: Q466K

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: Q466K

Domain	Start	End	E-Value	Type
CH	43	143	3.02e-28	SMART
CH	162	260	8.73e-25	SMART
SPEC	292	398	2.03e0	SMART
SPEC	412	512	6.42e-26	SMART
SPEC	518	622	4.61e-27	SMART
SPEC	628	728	2.36e-33	SMART
SPEC	734	833	1.2e-25	SMART
SPEC	839	939	7.16e-24	SMART
SPEC	945	1046	6.58e-23	SMART
SPEC	1052	1153	1.79e-24	SMART
SPEC	1159	1259	2.2e-24	SMART
SPEC	1265	1364	5.18e-21	SMART
SPEC	1370	1469	1.02e-19	SMART
SPEC	1475	1576	7.2e-29	SMART
SPEC	1582	1682	8.03e-27	SMART
SPEC	1688	1789	9.73e-26	SMART
SPEC	1795	1895	9.82e-22	SMART
SPEC	1901	2001	8.68e-23	SMART
SPEC	2007	2114	2.66e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124231
AA Change: Q479K

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: Q479K

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2092	6.42e-2	SMART

Meta Mutation Damage Score

0.0879

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apc2	G	A	10: 80,143,393 (GRCm39)	G498R	possibly damaging	Het
Bltp1	T	A	3: 36,939,547 (GRCm39)	F134I	possibly damaging	Het
Bub1	A	G	2: 127,656,676 (GRCm39)		probably benign	Het
Cttnbp2	C	T	6: 18,434,905 (GRCm39)	V318M	probably benign	Het
D430041D05Rik	T	C	2: 104,044,522 (GRCm39)	I825M	possibly damaging	Het
Enpp6	A	G	8: 47,519,027 (GRCm39)	Q265R	probably benign	Het
Eri1	A	G	8: 35,958,448 (GRCm39)	V61A	possibly damaging	Het
Evi2	T	A	11: 79,406,472 (GRCm39)	I368F	probably benign	Het
Fat3	G	A	9: 15,909,567 (GRCm39)	S2145F	probably damaging	Het
Fkbp9	A	G	6: 56,845,890 (GRCm39)	T409A	probably benign	Het
Gtpbp4	A	G	13: 9,040,834 (GRCm39)	V97A	probably damaging	Het
Hapln1	C	T	13: 89,753,418 (GRCm39)	Q195*	probably null	Het
Helt	G	T	8: 46,745,315 (GRCm39)	N189K	probably benign	Het
Hint2	A	G	4: 43,654,771 (GRCm39)	V91A	probably damaging	Het
Ighv1-7	A	G	12: 114,502,266 (GRCm39)	I67T	probably damaging	Het
Kif26a	A	G	12: 112,146,323 (GRCm39)	E1803G	probably benign	Het
Lrrd1	G	A	5: 3,901,248 (GRCm39)	V518I	probably benign	Het
Marchf11	C	T	15: 26,387,952 (GRCm39)	A269V	probably damaging	Het
Mep1b	A	G	18: 21,217,226 (GRCm39)	N115S	possibly damaging	Het
Naif1	A	G	2: 32,342,637 (GRCm39)	R63G	probably damaging	Het
Nsmaf	A	G	4: 6,435,064 (GRCm39)	I126T	probably benign	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or52h7	G	A	7: 104,214,145 (GRCm39)	R239H	probably benign	Het
Or8g53	T	A	9: 39,683,920 (GRCm39)	M59L	probably benign	Het
Pcdhb3	A	G	18: 37,436,329 (GRCm39)	E765G	probably damaging	Het
Ppp4r4	C	T	12: 103,562,680 (GRCm39)	R550*	probably null	Het
Scgb2b3	C	T	7: 31,061,430 (GRCm39)		probably null	Het
Sgcz	T	C	8: 37,990,565 (GRCm39)	I263V	probably benign	Het
Slc15a1	C	T	14: 121,722,269 (GRCm39)	V211I	probably benign	Het
Slc25a21	G	T	12: 56,764,920 (GRCm39)		probably benign	Het
Snrnp200	C	A	2: 127,075,019 (GRCm39)		probably benign	Het
Spata31e5	T	C	1: 28,816,722 (GRCm39)	T437A	probably damaging	Het
Stag1	T	A	9: 100,826,838 (GRCm39)	V935D	probably benign	Het
Veph1	C	T	3: 66,162,313 (GRCm39)	C115Y	probably damaging	Het
Zc3h12a	T	C	4: 125,020,732 (GRCm39)	D37G	probably benign	Het
Zfand4	A	T	6: 116,270,776 (GRCm39)		probably benign	Het

Other mutations in Sptbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sptbn1	APN	11	30,060,818 (GRCm39)	nonsense	probably null
IGL01098:Sptbn1	APN	11	30,109,385 (GRCm39)	missense	probably damaging	1.00
IGL01843:Sptbn1	APN	11	30,054,623 (GRCm39)	missense	probably benign	0.02
IGL02070:Sptbn1	APN	11	30,095,979 (GRCm39)	missense	probably damaging	0.99
IGL02075:Sptbn1	APN	11	30,088,496 (GRCm39)	missense	probably damaging	1.00
IGL02094:Sptbn1	APN	11	30,050,659 (GRCm39)	missense	probably benign	0.01
IGL02102:Sptbn1	APN	11	30,087,427 (GRCm39)	missense	probably damaging	1.00
IGL02189:Sptbn1	APN	11	30,067,871 (GRCm39)	missense	probably damaging	1.00
IGL02256:Sptbn1	APN	11	30,070,990 (GRCm39)	missense	probably benign	0.24
IGL02301:Sptbn1	APN	11	30,092,129 (GRCm39)	missense	probably damaging	1.00
IGL02354:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02361:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02377:Sptbn1	APN	11	30,069,491 (GRCm39)	missense	possibly damaging	0.92
IGL02504:Sptbn1	APN	11	30,092,293 (GRCm39)	missense	probably damaging	1.00
IGL02672:Sptbn1	APN	11	30,087,239 (GRCm39)	missense	probably damaging	1.00
IGL02733:Sptbn1	APN	11	30,147,747 (GRCm39)	missense	probably benign	0.12
IGL02755:Sptbn1	APN	11	30,092,247 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0096:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0139:Sptbn1	UTSW	11	30,092,289 (GRCm39)	missense	probably benign	0.00
R0370:Sptbn1	UTSW	11	30,071,545 (GRCm39)	missense	probably benign
R0389:Sptbn1	UTSW	11	30,089,250 (GRCm39)	missense	possibly damaging	0.95
R0415:Sptbn1	UTSW	11	30,099,576 (GRCm39)	missense	probably damaging	1.00
R0552:Sptbn1	UTSW	11	30,095,985 (GRCm39)	missense	possibly damaging	0.92
R0601:Sptbn1	UTSW	11	30,100,008 (GRCm39)	missense	probably damaging	1.00
R0609:Sptbn1	UTSW	11	30,088,979 (GRCm39)	missense	probably damaging	1.00
R0675:Sptbn1	UTSW	11	30,067,903 (GRCm39)	missense	probably damaging	1.00
R0708:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0711:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0729:Sptbn1	UTSW	11	30,060,902 (GRCm39)	missense	probably damaging	0.96
R0755:Sptbn1	UTSW	11	30,089,016 (GRCm39)	missense	probably damaging	1.00
R0892:Sptbn1	UTSW	11	30,092,201 (GRCm39)	missense	probably damaging	1.00
R0927:Sptbn1	UTSW	11	30,071,591 (GRCm39)	missense	probably damaging	1.00
R1102:Sptbn1	UTSW	11	30,070,785 (GRCm39)	missense	possibly damaging	0.93
R1460:Sptbn1	UTSW	11	30,088,637 (GRCm39)	missense	possibly damaging	0.50
R1479:Sptbn1	UTSW	11	30,063,909 (GRCm39)	missense	probably damaging	1.00
R1496:Sptbn1	UTSW	11	30,071,498 (GRCm39)	missense	probably damaging	1.00
R1649:Sptbn1	UTSW	11	30,087,301 (GRCm39)	missense	probably damaging	0.97
R1663:Sptbn1	UTSW	11	30,070,783 (GRCm39)	missense	possibly damaging	0.53
R1671:Sptbn1	UTSW	11	30,092,245 (GRCm39)	missense	possibly damaging	0.57
R1680:Sptbn1	UTSW	11	30,109,371 (GRCm39)	missense	possibly damaging	0.92
R1695:Sptbn1	UTSW	11	30,086,124 (GRCm39)	missense	probably benign	0.13
R1868:Sptbn1	UTSW	11	30,064,781 (GRCm39)	missense	possibly damaging	0.70
R1918:Sptbn1	UTSW	11	30,092,414 (GRCm39)	missense	probably damaging	1.00
R1921:Sptbn1	UTSW	11	30,054,469 (GRCm39)	missense	probably damaging	0.98
R2026:Sptbn1	UTSW	11	30,054,559 (GRCm39)	missense	probably benign	0.02
R2038:Sptbn1	UTSW	11	30,109,293 (GRCm39)	critical splice donor site	probably null
R2047:Sptbn1	UTSW	11	30,088,360 (GRCm39)	splice site	probably benign
R2312:Sptbn1	UTSW	11	30,104,249 (GRCm39)	missense	probably damaging	1.00
R3430:Sptbn1	UTSW	11	30,169,686 (GRCm39)	missense	possibly damaging	0.67
R3624:Sptbn1	UTSW	11	30,090,593 (GRCm39)	missense	probably damaging	1.00
R3723:Sptbn1	UTSW	11	30,087,335 (GRCm39)	missense	possibly damaging	0.59
R4446:Sptbn1	UTSW	11	30,089,114 (GRCm39)	missense	possibly damaging	0.70
R4582:Sptbn1	UTSW	11	30,169,597 (GRCm39)	missense	probably damaging	1.00
R4705:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign
R4707:Sptbn1	UTSW	11	30,087,197 (GRCm39)	missense	possibly damaging	0.61
R4718:Sptbn1	UTSW	11	30,104,297 (GRCm39)	missense	probably damaging	1.00
R4789:Sptbn1	UTSW	11	30,067,759 (GRCm39)	missense	probably benign
R4824:Sptbn1	UTSW	11	30,068,295 (GRCm39)	missense	possibly damaging	0.72
R4855:Sptbn1	UTSW	11	30,092,353 (GRCm39)	missense	probably damaging	1.00
R5009:Sptbn1	UTSW	11	30,074,016 (GRCm39)	missense	probably benign	0.05
R5071:Sptbn1	UTSW	11	30,063,854 (GRCm39)	critical splice donor site	probably null
R5153:Sptbn1	UTSW	11	30,071,510 (GRCm39)	missense	possibly damaging	0.82
R5334:Sptbn1	UTSW	11	30,087,364 (GRCm39)	missense	possibly damaging	0.92
R5462:Sptbn1	UTSW	11	30,050,520 (GRCm39)	missense	possibly damaging	0.94
R5523:Sptbn1	UTSW	11	30,087,560 (GRCm39)	missense	probably damaging	1.00
R5707:Sptbn1	UTSW	11	30,093,174 (GRCm39)	missense	possibly damaging	0.65
R5724:Sptbn1	UTSW	11	30,094,113 (GRCm39)	missense	possibly damaging	0.91
R5738:Sptbn1	UTSW	11	30,095,941 (GRCm39)	missense	probably damaging	1.00
R5864:Sptbn1	UTSW	11	30,095,925 (GRCm39)	missense	probably damaging	1.00
R5895:Sptbn1	UTSW	11	30,073,978 (GRCm39)	missense	probably damaging	0.99
R5932:Sptbn1	UTSW	11	30,086,136 (GRCm39)	missense	probably damaging	1.00
R5966:Sptbn1	UTSW	11	30,074,873 (GRCm39)	missense	probably damaging	1.00
R5984:Sptbn1	UTSW	11	30,068,464 (GRCm39)	missense	probably damaging	1.00
R6155:Sptbn1	UTSW	11	30,087,403 (GRCm39)	missense	probably damaging	0.99
R6163:Sptbn1	UTSW	11	30,109,443 (GRCm39)	nonsense	probably null
R6226:Sptbn1	UTSW	11	30,086,054 (GRCm39)	missense	probably damaging	1.00
R6271:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign	0.00
R6443:Sptbn1	UTSW	11	30,089,429 (GRCm39)	missense	possibly damaging	0.56
R6591:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6616:Sptbn1	UTSW	11	30,074,030 (GRCm39)	missense	probably benign	0.08
R6691:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6751:Sptbn1	UTSW	11	30,067,859 (GRCm39)	missense	probably damaging	1.00
R6823:Sptbn1	UTSW	11	30,064,787 (GRCm39)	missense	probably damaging	1.00
R6863:Sptbn1	UTSW	11	30,096,777 (GRCm39)	missense	possibly damaging	0.94
R6885:Sptbn1	UTSW	11	30,088,634 (GRCm39)	missense	probably benign	0.26
R6892:Sptbn1	UTSW	11	30,092,187 (GRCm39)	missense	probably benign	0.27
R6998:Sptbn1	UTSW	11	30,050,633 (GRCm39)	missense	probably damaging	0.97
R7043:Sptbn1	UTSW	11	30,053,323 (GRCm39)	missense	probably benign	0.02
R7092:Sptbn1	UTSW	11	30,087,119 (GRCm39)	missense	possibly damaging	0.75
R7272:Sptbn1	UTSW	11	30,064,859 (GRCm39)	missense	possibly damaging	0.93
R7301:Sptbn1	UTSW	11	30,067,798 (GRCm39)	nonsense	probably null
R7379:Sptbn1	UTSW	11	30,089,292 (GRCm39)	missense	possibly damaging	0.72
R7774:Sptbn1	UTSW	11	30,092,142 (GRCm39)	missense	probably damaging	0.99
R7813:Sptbn1	UTSW	11	30,088,455 (GRCm39)	missense	probably damaging	1.00
R7837:Sptbn1	UTSW	11	30,088,832 (GRCm39)	missense	probably damaging	1.00
R7843:Sptbn1	UTSW	11	30,104,320 (GRCm39)	missense	probably damaging	1.00
R7846:Sptbn1	UTSW	11	30,092,153 (GRCm39)	missense	probably damaging	0.98
R7877:Sptbn1	UTSW	11	30,079,601 (GRCm39)	missense	possibly damaging	0.94
R7902:Sptbn1	UTSW	11	30,086,048 (GRCm39)	missense	probably damaging	1.00
R8060:Sptbn1	UTSW	11	30,051,616 (GRCm39)	missense	probably damaging	0.99
R8116:Sptbn1	UTSW	11	30,089,117 (GRCm39)	missense	probably damaging	1.00
R8169:Sptbn1	UTSW	11	30,147,783 (GRCm39)	missense	possibly damaging	0.62
R8208:Sptbn1	UTSW	11	30,074,972 (GRCm39)	missense	probably damaging	1.00
R8247:Sptbn1	UTSW	11	30,063,906 (GRCm39)	missense	possibly damaging	0.84
R8412:Sptbn1	UTSW	11	30,088,457 (GRCm39)	missense	probably damaging	1.00
R8470:Sptbn1	UTSW	11	30,070,758 (GRCm39)	missense	possibly damaging	0.78
R8544:Sptbn1	UTSW	11	30,169,750 (GRCm39)	start gained	probably benign
R8674:Sptbn1	UTSW	11	30,089,352 (GRCm39)	missense	possibly damaging	0.73
R8846:Sptbn1	UTSW	11	30,075,009 (GRCm39)	missense	possibly damaging	0.77
R8889:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8892:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8927:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8928:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8975:Sptbn1	UTSW	11	30,073,869 (GRCm39)	missense	possibly damaging	0.86
R9115:Sptbn1	UTSW	11	30,087,526 (GRCm39)	missense	probably damaging	1.00
R9127:Sptbn1	UTSW	11	30,104,356 (GRCm39)	missense	probably damaging	1.00
R9193:Sptbn1	UTSW	11	30,087,551 (GRCm39)	missense	possibly damaging	0.77
R9237:Sptbn1	UTSW	11	30,096,803 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30,147,787 (GRCm39)	missense	probably benign	0.13
Z1176:Sptbn1	UTSW	11	30,087,439 (GRCm39)	missense	probably damaging	1.00
Z1177:Sptbn1	UTSW	11	30,070,659 (GRCm39)	missense	probably benign	0.27
Z1177:Sptbn1	UTSW	11	30,064,734 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAGAAGGTCTGACTGCGTC -3'
(R):5'- CAGCTTACGCACTGTATTGTG -3'

Sequencing Primer
(F):5'- TGACTGCGTCAGCTCTGG -3'
(R):5'- CACTGTATTGTGCTCCCCC -3'

Posted On

2015-04-06