Incidental Mutation 'R4608:Zfand4'
ID350879
Institutional Source Beutler Lab
Gene Symbol Zfand4
Ensembl Gene ENSMUSG00000042213
Gene Namezinc finger, AN1-type domain 4
SynonymsAnubl1, 2810002D23Rik
MMRRC Submission 041819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4608 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116264222-116330302 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 116328234 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 207 (C207*)
Ref Sequence ENSEMBL: ENSMUSP00000152064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036503] [ENSMUST00000112900] [ENSMUST00000222494] [ENSMUST00000222819] [ENSMUST00000223495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036503
AA Change: V665E

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040057
Gene: ENSMUSG00000042213
AA Change: V665E

DomainStartEndE-ValueType
low complexity region 118 151 N/A INTRINSIC
low complexity region 458 472 N/A INTRINSIC
ZnF_AN1 554 592 4.18e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069169
AA Change: V438E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068223
Gene: ENSMUSG00000042213
AA Change: V438E

DomainStartEndE-ValueType
low complexity region 16 49 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
ZnF_AN1 452 490 4.18e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112900
AA Change: V684E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108521
Gene: ENSMUSG00000042213
AA Change: V684E

DomainStartEndE-ValueType
UBQ 54 125 4.11e-15 SMART
low complexity region 262 295 N/A INTRINSIC
low complexity region 602 616 N/A INTRINSIC
ZnF_AN1 698 736 4.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221824
Predicted Effect probably benign
Transcript: ENSMUST00000222494
Predicted Effect probably benign
Transcript: ENSMUST00000222819
Predicted Effect probably null
Transcript: ENSMUST00000223495
AA Change: C207*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,418,029 I74V unknown Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adam10 T C 9: 70,743,891 L66P probably damaging Het
Adamts18 A T 8: 113,737,613 C738S probably damaging Het
Adamts7 T G 9: 90,174,540 S221A probably damaging Het
Adrm1 A G 2: 180,174,855 probably benign Het
Aqp1 T C 6: 55,336,639 V50A possibly damaging Het
Aqp4 T C 18: 15,398,126 I193V probably benign Het
B130006D01Rik A T 11: 95,726,240 probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcdc2a T A 13: 25,061,240 L100* probably null Het
Eif4g3 G T 4: 138,126,458 R618L probably benign Het
F5 C T 1: 164,209,029 P1920S probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fancc C A 13: 63,331,823 probably benign Het
Fastk G T 5: 24,443,119 P233H probably damaging Het
Fbn1 A C 2: 125,306,500 D2609E probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fmnl2 T A 2: 53,103,716 N374K possibly damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gckr A G 5: 31,307,797 D370G probably damaging Het
Ggt6 T C 11: 72,437,943 M385T probably benign Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm6588 A G 5: 112,449,898 S104G possibly damaging Het
Gsg1l T A 7: 125,958,549 I136F probably damaging Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints1 C T 5: 139,759,844 S1353N probably benign Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ints6 T G 14: 62,703,229 R557S probably damaging Het
Ints9 T A 14: 65,032,280 I473N possibly damaging Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kif1a C A 1: 93,024,646 A1304S possibly damaging Het
Kif21b C T 1: 136,148,186 probably benign Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Krtap4-8 C T 11: 99,780,495 probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Lrch4 T A 5: 137,639,146 L526* probably null Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Nod1 C A 6: 54,943,756 A526S probably damaging Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Nxf1 A G 19: 8,762,763 D98G probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr31 A G 14: 14,328,887 M259V probably benign Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Osgep T C 14: 50,917,921 Y60C probably damaging Het
P2ry6 A G 7: 100,938,304 Y283H probably damaging Het
Pcdha7 A T 18: 36,975,817 S632C possibly damaging Het
Pms1 T A 1: 53,194,938 R806S possibly damaging Het
Qars T A 9: 108,509,426 probably null Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slc12a5 A T 2: 164,973,765 N67I probably damaging Het
Slc1a4 G T 11: 20,304,348 T506K probably damaging Het
Tlr9 T A 9: 106,224,974 I488N probably damaging Het
Tmem110 C A 14: 30,872,533 probably benign Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Xab2 A G 8: 3,618,105 S158P probably benign Het
Ythdc1 T C 5: 86,822,808 S418P probably damaging Het
Zfp367 C T 13: 64,135,424 D305N probably damaging Het
Zfp804b C T 5: 6,772,584 V160I probably benign Het
Other mutations in Zfand4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Zfand4 APN 6 116314869 missense probably benign 0.14
IGL02001:Zfand4 APN 6 116273652 missense probably benign 0.11
IGL02047:Zfand4 APN 6 116314928 missense probably damaging 1.00
IGL02887:Zfand4 APN 6 116273656 missense possibly damaging 0.66
IGL02943:Zfand4 APN 6 116273876 splice site probably benign
IGL03058:Zfand4 APN 6 116288077 missense probably benign 0.03
IGL03130:Zfand4 APN 6 116273659 missense probably damaging 0.99
IGL03253:Zfand4 APN 6 116284809 missense probably damaging 1.00
PIT4802001:Zfand4 UTSW 6 116284775 missense probably damaging 1.00
R0015:Zfand4 UTSW 6 116328297 missense probably damaging 1.00
R0133:Zfand4 UTSW 6 116314739 missense probably benign 0.02
R0446:Zfand4 UTSW 6 116288054 missense probably benign 0.29
R0508:Zfand4 UTSW 6 116285867 missense probably damaging 1.00
R1385:Zfand4 UTSW 6 116273638 missense probably damaging 1.00
R1577:Zfand4 UTSW 6 116329412 nonsense probably null
R2179:Zfand4 UTSW 6 116314781 missense possibly damaging 0.92
R3862:Zfand4 UTSW 6 116293815 intron probably benign
R4607:Zfand4 UTSW 6 116328234 nonsense probably null
R4720:Zfand4 UTSW 6 116288161 critical splice donor site probably null
R4724:Zfand4 UTSW 6 116273819 missense probably damaging 1.00
R4771:Zfand4 UTSW 6 116314350 missense probably damaging 1.00
R5541:Zfand4 UTSW 6 116314295 missense possibly damaging 0.50
R5721:Zfand4 UTSW 6 116287995 missense probably damaging 1.00
R5901:Zfand4 UTSW 6 116288123 missense probably damaging 0.99
R6253:Zfand4 UTSW 6 116273614 missense probably damaging 0.97
R6798:Zfand4 UTSW 6 116328253 missense probably benign 0.01
R7030:Zfand4 UTSW 6 116305657 missense probably benign 0.01
R7081:Zfand4 UTSW 6 116315620 missense possibly damaging 0.71
R7082:Zfand4 UTSW 6 116328376 intron probably null
Z1176:Zfand4 UTSW 6 116313921 missense probably damaging 0.98
Z1177:Zfand4 UTSW 6 116313921 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAACATCTGCTGCCACTTCATTTC -3'
(R):5'- AGGAATTCATGTGAGGGCTGC -3'

Sequencing Primer
(F):5'- CGGCTGTTCAAAAGTACA -3'
(R):5'- GAGGGCTGCTATTAGAACATCATCTG -3'
Posted On2015-10-08