Incidental Mutation 'R3928:Atrx'
ID308397
Institutional Source Beutler Lab
Gene Symbol Atrx
Ensembl Gene ENSMUSG00000031229
Gene NameATRX, chromatin remodeler
SynonymsDXHXS6677E, Rad54, 4833408C14Rik, Hp1bp2, Xnp, HP1-BP38, XH2
MMRRC Submission 040823-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R3928 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location105797615-105929403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105879917 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 157 (I157V)
Ref Sequence ENSEMBL: ENSMUSP00000143565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101305] [ENSMUST00000113573] [ENSMUST00000128968] [ENSMUST00000134381] [ENSMUST00000134507] [ENSMUST00000137453] [ENSMUST00000150914] [ENSMUST00000154866] [ENSMUST00000197302] [ENSMUST00000198209] [ENSMUST00000198441] [ENSMUST00000198448] [ENSMUST00000199233]
Predicted Effect probably benign
Transcript: ENSMUST00000101305
SMART Domains Protein: ENSMUSP00000098863
Gene: ENSMUSG00000031229

DomainStartEndE-ValueType
low complexity region 40 50 N/A INTRINSIC
low complexity region 81 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113573
AA Change: I195V

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109203
Gene: ENSMUSG00000031229
AA Change: I195V

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
RING 219 267 4.61e-1 SMART
low complexity region 312 322 N/A INTRINSIC
low complexity region 774 789 N/A INTRINSIC
low complexity region 822 837 N/A INTRINSIC
low complexity region 929 946 N/A INTRINSIC
low complexity region 1021 1039 N/A INTRINSIC
low complexity region 1130 1143 N/A INTRINSIC
low complexity region 1145 1165 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
low complexity region 1238 1245 N/A INTRINSIC
low complexity region 1264 1279 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1341 1354 N/A INTRINSIC
low complexity region 1373 1386 N/A INTRINSIC
low complexity region 1407 1416 N/A INTRINSIC
low complexity region 1430 1454 N/A INTRINSIC
coiled coil region 1472 1511 N/A INTRINSIC
DEXDc 1541 1761 2.44e-25 SMART
low complexity region 1898 1932 N/A INTRINSIC
low complexity region 1947 1959 N/A INTRINSIC
low complexity region 1969 1982 N/A INTRINSIC
HELICc 2031 2138 6.1e-17 SMART
low complexity region 2245 2266 N/A INTRINSIC
low complexity region 2397 2413 N/A INTRINSIC
low complexity region 2452 2461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123174
Predicted Effect possibly damaging
Transcript: ENSMUST00000128968
AA Change: I156V

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121416
Gene: ENSMUSG00000031229
AA Change: I156V

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
RING 180 228 2.2e-3 SMART
low complexity region 273 283 N/A INTRINSIC
low complexity region 735 750 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
low complexity region 982 993 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133543
Predicted Effect probably benign
Transcript: ENSMUST00000134381
AA Change: I102V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122875
Gene: ENSMUSG00000031229
AA Change: I102V

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
RING 126 174 4.61e-1 SMART
low complexity region 219 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134507
AA Change: I118V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123085
Gene: ENSMUSG00000031229
AA Change: I118V

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
RING 142 190 4.61e-1 SMART
low complexity region 235 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137453
SMART Domains Protein: ENSMUSP00000120246
Gene: ENSMUSG00000031229

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150914
AA Change: I156V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000122034
Gene: ENSMUSG00000031229
AA Change: I156V

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
RING 180 228 4.61e-1 SMART
low complexity region 273 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154866
AA Change: I139V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121291
Gene: ENSMUSG00000031229
AA Change: I139V

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
PDB:2LD1|A 103 208 6e-77 PDB
SCOP:d1fp0a1 157 208 5e-7 SMART
Blast:RING 163 208 5e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197302
AA Change: I109V

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143163
Gene: ENSMUSG00000031229
AA Change: I109V

DomainStartEndE-ValueType
PDB:2JM1|A 72 134 6e-42 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000198209
SMART Domains Protein: ENSMUSP00000142726
Gene: ENSMUSG00000031229

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 142 160 N/A INTRINSIC
internal_repeat_1 171 196 2.95e-5 PROSPERO
internal_repeat_1 218 241 2.95e-5 PROSPERO
low complexity region 251 264 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 422 431 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
low complexity region 486 499 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198441
AA Change: I157V

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143565
Gene: ENSMUSG00000031229
AA Change: I157V

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
PDB:2JM1|A 123 174 3e-32 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000198448
AA Change: I140V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143090
Gene: ENSMUSG00000031229
AA Change: I140V

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
RING 164 212 2.2e-3 SMART
low complexity region 257 267 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199233
AA Change: I102V

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143015
Gene: ENSMUSG00000031229
AA Change: I102V

DomainStartEndE-ValueType
low complexity region 11 29 N/A INTRINSIC
PDB:2JM1|A 68 158 2e-64 PDB
SCOP:d1fp0a1 120 154 9e-6 SMART
Blast:RING 126 158 9e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000200471
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATPase/helicase domain, and thus it belongs to the SWI/SNF family of chromatin remodeling proteins. This protein is found to undergo cell cycle-dependent phosphorylation, which regulates its nuclear matrix and chromatin association, and suggests its involvement in the gene regulation at interphase and chromosomal segregation in mitosis. Mutations in this gene are associated with an X-linked mental retardation (XLMR) syndrome most often accompanied by alpha-thalassemia (ATRX) syndrome. These mutations have been shown to cause diverse changes in the pattern of DNA methylation, which may provide a link between chromatin remodeling, DNA methylation, and gene expression in developmental processes. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a floxed allele activated in different tissues at different time points can serve as a model of alpha-thalassemia/mental retardation syndrome, nondeletion type, X-linked. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,468,735 H181Q probably benign Het
Birc6 A G 17: 74,611,175 D1856G possibly damaging Het
Birc6 A G 17: 74,638,409 T2811A probably damaging Het
Brsk2 T C 7: 141,998,418 F108S probably damaging Het
Clasp2 C A 9: 113,906,105 H1004N probably benign Het
Cntd1 G A 11: 101,287,519 V315I probably benign Het
Col13a1 A G 10: 61,867,525 probably benign Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dpysl2 A G 14: 66,824,431 I242T possibly damaging Het
Exoc3l C T 8: 105,290,917 probably benign Het
Fam229a A G 4: 129,491,411 probably benign Het
Fshr C T 17: 88,985,534 R572H probably damaging Het
Gm5501 A G 18: 9,917,267 noncoding transcript Het
Gmpr A G 13: 45,529,747 I165V probably benign Het
Gnat3 G A 5: 18,003,894 probably benign Het
H1foo A G 6: 115,948,796 K185E probably benign Het
H2-Q4 T G 17: 35,379,690 L16R unknown Het
Hs2st1 T C 3: 144,434,628 K311E possibly damaging Het
Kcnj15 A G 16: 95,296,509 E330G possibly damaging Het
Kif3a A G 11: 53,570,614 K29E probably benign Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Lmntd2 C T 7: 141,211,204 G432S probably damaging Het
Me3 T C 7: 89,833,690 probably benign Het
Myo1d G T 11: 80,484,261 R996S probably benign Het
Myo9a T A 9: 59,895,283 W2018R probably damaging Het
Nphp3 G T 9: 104,011,730 V265F probably damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr492 A G 7: 108,323,025 I217T probably benign Het
Olfr894 T C 9: 38,218,835 M1T probably null Het
Pgp A G 17: 24,471,341 E247G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plch1 G A 3: 63,767,623 A202V probably damaging Het
Rbm11 G A 16: 75,593,044 probably null Het
Scg5 T C 2: 113,791,885 K124R probably damaging Het
Serpina3j A T 12: 104,319,657 H357L probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Tdpoz3 T C 3: 93,826,909 I297T possibly damaging Het
Tdrd5 G A 1: 156,300,778 T136I probably benign Het
Tfcp2l1 T A 1: 118,669,476 I429K possibly damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Top1 T C 2: 160,687,749 probably benign Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r183 T C 7: 24,055,572 S267P probably damaging Het
Xirp2 T A 2: 67,511,669 F1418Y possibly damaging Het
Zfp114 T C 7: 24,181,042 V271A possibly damaging Het
Zfp710 A G 7: 80,081,386 R104G probably damaging Het
Other mutations in Atrx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Atrx APN X 105823799 missense probably damaging 0.99
IGL01293:Atrx APN X 105876195 missense probably benign 0.02
IGL01383:Atrx APN X 105802075 missense probably damaging 0.98
IGL01701:Atrx APN X 105830920 missense probably damaging 1.00
IGL02252:Atrx APN X 105845823 missense possibly damaging 0.89
IGL02411:Atrx APN X 105830981 missense possibly damaging 0.82
IGL02929:Atrx APN X 105879906 splice site probably null
IGL03004:Atrx APN X 105832509 nonsense probably null
R1799:Atrx UTSW X 105847629 missense probably damaging 1.00
R2920:Atrx UTSW X 105830868 missense probably benign 0.22
R3929:Atrx UTSW X 105879917 missense possibly damaging 0.91
X0028:Atrx UTSW X 105877412 missense probably damaging 0.99
X0060:Atrx UTSW X 105847687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAATACAGTAAGTCTCCCCTCCC -3'
(R):5'- CCCAAGACATTTTCCCACGG -3'

Sequencing Primer
(F):5'- CACTTAACTCAACTAACTCTTACTCG -3'
(R):5'- CCCACGGATTATGAACTCTAGTG -3'
Posted On2015-04-17