Incidental Mutation 'R3939:Hip1'
ID308594
Institutional Source Beutler Lab
Gene Symbol Hip1
Ensembl Gene ENSMUSG00000039959
Gene Namehuntingtin interacting protein 1
SynonymsHIP-1, 2610109B09Rik, A930014B11Rik, E130315I21Rik
MMRRC Submission 040826-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R3939 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135406531-135545120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135428764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 285 (I285N)
Ref Sequence ENSEMBL: ENSMUSP00000144086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060311] [ENSMUST00000202643]
Predicted Effect probably benign
Transcript: ENSMUST00000060311
AA Change: I696N

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000059033
Gene: ENSMUSG00000039959
AA Change: I696N

DomainStartEndE-ValueType
ENTH 38 160 9.98e-41 SMART
PDB:3I00|B 361 480 9e-57 PDB
Pfam:HIP1_clath_bdg 482 572 2.1e-27 PFAM
low complexity region 649 658 N/A INTRINSIC
low complexity region 780 796 N/A INTRINSIC
ILWEQ 806 1004 9.05e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201479
Predicted Effect probably benign
Transcript: ENSMUST00000202643
AA Change: I285N

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144086
Gene: ENSMUSG00000039959
AA Change: I285N

DomainStartEndE-ValueType
PDB:2QA7|D 1 70 9e-34 PDB
Pfam:HIP1_clath_bdg 71 161 4.4e-24 PFAM
low complexity region 238 247 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
ILWEQ 395 593 5.7e-122 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that functions in clathrin-mediated endocytosis and protein trafficking within the cell. The encoded protein binds to the huntingtin protein in the brain; this interaction is lost in Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutants may exhibit axial skeleton defects, hematopotietic abnormalities, and testicular degeneration with increased apoptosis of postmeiotic spermatids. One line showed microphthalmia and cataracts, whereas others did not. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Atp13a2 T C 4: 141,006,422 S1041P probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Col13a1 T C 10: 61,863,082 I491V unknown Het
Corin T C 5: 72,339,879 D531G possibly damaging Het
Cx3cr1 C T 9: 120,051,644 V231I probably benign Het
Dennd4c T G 4: 86,774,280 V9G probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Faf1 T G 4: 109,861,879 L394R probably damaging Het
Fgfr4 G A 13: 55,156,494 D116N probably null Het
Flt3 A G 5: 147,356,243 Y518H possibly damaging Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gk2 T A 5: 97,455,352 L542F possibly damaging Het
Gm4922 T A 10: 18,784,614 E120V probably damaging Het
Kcnd2 C A 6: 21,217,096 D266E probably damaging Het
Kdr C T 5: 75,972,429 W63* probably null Het
Kit A G 5: 75,609,318 D130G probably benign Het
Megf8 G A 7: 25,359,202 V2208I probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nktr T A 9: 121,749,069 probably benign Het
Nrxn1 A G 17: 90,208,421 I1207T probably damaging Het
Obox7 G A 7: 14,664,047 G4D probably benign Het
Ogdh G A 11: 6,350,655 W827* probably null Het
Olfr1223 T A 2: 89,144,130 K298* probably null Het
Olfr309 T C 7: 86,306,229 M295V probably benign Het
Olfr726 A G 14: 50,083,716 *322Q probably null Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sbpl T A 17: 23,953,643 I101L probably benign Het
Serpina9 T A 12: 104,008,892 M1L probably benign Het
Stxbp6 A G 12: 44,902,858 probably null Het
Synpo2 A G 3: 123,114,590 V359A probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Vil1 A G 1: 74,432,415 D785G probably benign Het
Zfp345 G A 2: 150,472,553 H355Y probably damaging Het
Other mutations in Hip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Hip1 APN 5 135449822 missense probably damaging 1.00
IGL00418:Hip1 APN 5 135426346 missense probably damaging 1.00
IGL01744:Hip1 APN 5 135545063 utr 5 prime probably benign
IGL02494:Hip1 APN 5 135444791 nonsense probably null
IGL02749:Hip1 APN 5 135444751 missense probably benign 0.00
IGL03219:Hip1 APN 5 135457050 missense probably benign 0.16
IGL03328:Hip1 APN 5 135424874 missense probably damaging 1.00
BB010:Hip1 UTSW 5 135460456 missense probably damaging 0.98
BB020:Hip1 UTSW 5 135460456 missense probably damaging 0.98
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0336:Hip1 UTSW 5 135428613 missense probably benign 0.39
R0410:Hip1 UTSW 5 135458155 missense probably damaging 1.00
R1454:Hip1 UTSW 5 135438632 missense probably benign
R1530:Hip1 UTSW 5 135444780 missense probably damaging 1.00
R1848:Hip1 UTSW 5 135435141 splice site probably null
R2201:Hip1 UTSW 5 135431730 missense probably benign
R2246:Hip1 UTSW 5 135452844 missense probably damaging 1.00
R2276:Hip1 UTSW 5 135457046 missense probably damaging 1.00
R2353:Hip1 UTSW 5 135412712 missense probably damaging 1.00
R3013:Hip1 UTSW 5 135435039 missense possibly damaging 0.91
R3413:Hip1 UTSW 5 135422172 missense probably damaging 1.00
R4153:Hip1 UTSW 5 135412706 missense probably damaging 1.00
R4839:Hip1 UTSW 5 135426318 splice site probably null
R5059:Hip1 UTSW 5 135449821 missense probably damaging 1.00
R5171:Hip1 UTSW 5 135440302 missense probably damaging 1.00
R5189:Hip1 UTSW 5 135434293 missense probably damaging 1.00
R5358:Hip1 UTSW 5 135436398 missense probably benign 0.22
R5642:Hip1 UTSW 5 135433085 nonsense probably null
R5646:Hip1 UTSW 5 135428741 missense probably damaging 0.98
R5831:Hip1 UTSW 5 135411263 missense probably benign 0.00
R5908:Hip1 UTSW 5 135424863 critical splice donor site probably null
R6484:Hip1 UTSW 5 135440129 missense probably damaging 1.00
R6535:Hip1 UTSW 5 135428497 splice site probably null
R6557:Hip1 UTSW 5 135428719 missense possibly damaging 0.67
R7459:Hip1 UTSW 5 135414297 missense probably damaging 1.00
R7589:Hip1 UTSW 5 135414311 missense probably benign
R7677:Hip1 UTSW 5 135430317 missense probably benign
R7933:Hip1 UTSW 5 135460456 missense probably damaging 0.98
R8267:Hip1 UTSW 5 135428613 missense probably benign 0.39
Z1177:Hip1 UTSW 5 135428606 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGGGTTTCTCTGCCATACTG -3'
(R):5'- GCCAGGTTCAAATATCTCCCTAG -3'

Sequencing Primer
(F):5'- GGTTTCTCTGCCATACTGCCTAC -3'
(R):5'- ACTTCAGTTAAGTGGATCTGACGCC -3'
Posted On2015-04-17