Incidental Mutation 'R3881:Angptl4'
ID308794
Institutional Source Beutler Lab
Gene Symbol Angptl4
Ensembl Gene ENSMUSG00000002289
Gene Nameangiopoietin-like 4
SynonymsFIAF, BK89, NG27, HFARP
MMRRC Submission 040795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3881 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33773750-33781575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33777034 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 323 (P323S)
Ref Sequence ENSEMBL: ENSMUSP00000002360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002360] [ENSMUST00000173869]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002360
AA Change: P323S

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002360
Gene: ENSMUSG00000002289
AA Change: P323S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 151 N/A INTRINSIC
FBG 187 404 6.6e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173869
SMART Domains Protein: ENSMUSP00000133417
Gene: ENSMUSG00000002289

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174872
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased levels of triglycerides and cholesterol and a lower increase in body fat after exposure to gut microbiota. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik T G 19: 4,498,389 K44T possibly damaging Het
4933402N03Rik T C 7: 131,139,094 E131G probably benign Het
9530053A07Rik T A 7: 28,140,038 C425* probably null Het
Cep41 A G 6: 30,658,398 S201P probably damaging Het
Cep95 A G 11: 106,806,292 I257V probably damaging Het
Clca4a T C 3: 144,957,318 N590S probably benign Het
Cyfip2 A G 11: 46,208,335 L716P probably damaging Het
Cyp2d34 T A 15: 82,618,617 Q136L probably benign Het
Def6 T C 17: 28,220,215 C267R probably damaging Het
Dgat2 G A 7: 99,169,743 Q69* probably null Het
Dlgap1 T A 17: 70,786,815 S710R probably damaging Het
Dnah10 T C 5: 124,773,031 I1539T probably benign Het
Dnah2 T A 11: 69,451,347 I2932F possibly damaging Het
Enpp2 A G 15: 54,919,692 S76P probably damaging Het
Esr2 T C 12: 76,167,620 D19G probably damaging Het
Fam13b A T 18: 34,462,059 probably null Het
Fbxw14 A T 9: 109,271,194 V464D possibly damaging Het
Gm21961 A G 15: 65,014,867 probably null Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hps5 A G 7: 46,771,996 V648A possibly damaging Het
Ints4 A G 7: 97,516,257 T517A possibly damaging Het
Itpr3 A G 17: 27,113,840 N1860S probably benign Het
Itsn2 G A 12: 4,634,546 probably benign Het
Jup A G 11: 100,378,381 V402A probably benign Het
Letm2 C A 8: 25,593,868 E116* probably null Het
Ly6c1 T C 15: 75,045,587 T71A probably benign Het
Mcm3ap G A 10: 76,506,446 S1591N probably benign Het
Mier2 C T 10: 79,548,750 probably null Het
Mocs2 T A 13: 114,819,346 L10* probably null Het
Myo6 A G 9: 80,264,256 D513G probably damaging Het
Myoz2 T C 3: 123,013,720 Y147C probably damaging Het
Nin C T 12: 70,042,541 V1367M probably benign Het
Nr2f6 C T 8: 71,376,031 A200T probably damaging Het
Obscn C T 11: 59,056,949 C4418Y probably damaging Het
Olfr1331 A G 4: 118,869,353 M191V probably benign Het
Olfr1495 T C 19: 13,768,780 V146A probably benign Het
Olfr154 T A 2: 85,664,425 H3L probably benign Het
Paxip1 C T 5: 27,748,839 R953Q probably damaging Het
Pcdha1 A T 18: 36,931,401 I373F possibly damaging Het
Pcdha7 G A 18: 36,975,379 E486K probably benign Het
Recql5 G A 11: 115,893,954 P849L probably benign Het
Recql5 G T 11: 115,893,955 P849T probably benign Het
Rnf180 A T 13: 105,250,407 M131K possibly damaging Het
Rplp1 A G 9: 61,914,422 S3P probably benign Het
Rpp38 T A 2: 3,329,246 R206S probably benign Het
Sdha G T 13: 74,339,192 P159Q probably damaging Het
Shank2 T C 7: 144,405,384 V199A probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Timm50 C A 7: 28,311,007 A41S probably benign Het
Tmbim1 A G 1: 74,289,998 probably benign Het
Tmprss11a C T 5: 86,445,805 V29M possibly damaging Het
Ttc28 A T 5: 111,183,240 H411L probably damaging Het
Ube4b A T 4: 149,365,404 probably null Het
Zdhhc22 T A 12: 86,983,626 M183L probably benign Het
Zfp106 A G 2: 120,532,149 S830P probably benign Het
Other mutations in Angptl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Angptl4 APN 17 33781268 missense probably damaging 1.00
R0117:Angptl4 UTSW 17 33780802 missense probably damaging 1.00
R1225:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1491:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1932:Angptl4 UTSW 17 33781275 nonsense probably null
R2055:Angptl4 UTSW 17 33780524 splice site probably null
R2212:Angptl4 UTSW 17 33775418 missense probably damaging 0.99
R2959:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R2963:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3877:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3882:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R4646:Angptl4 UTSW 17 33781299 missense probably benign 0.00
R4660:Angptl4 UTSW 17 33777275 intron probably benign
R6192:Angptl4 UTSW 17 33777041 missense probably benign 0.09
R6591:Angptl4 UTSW 17 33780781 critical splice donor site probably null
R6691:Angptl4 UTSW 17 33780781 critical splice donor site probably null
R7350:Angptl4 UTSW 17 33777110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCTCTGTGCCAGAATG -3'
(R):5'- TGCACAGCATCACAGGGAAC -3'

Sequencing Primer
(F):5'- TTCAATGACTGGCCCATAGG -3'
(R):5'- ACCGAGGAAGCCAATTGG -3'
Posted On2015-04-17