Incidental Mutation 'R4033:Lsm14b'
ID313567
Institutional Source Beutler Lab
Gene Symbol Lsm14b
Ensembl Gene ENSMUSG00000039108
Gene NameLSM family member 14B
Synonyms
MMRRC Submission 040961-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4033 (G1)
Quality Score200
Status Validated
Chromosome2
Chromosomal Location180024987-180035465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180031516 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 195 (K195E)
Ref Sequence ENSEMBL: ENSMUSP00000055036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029082] [ENSMUST00000055485] [ENSMUST00000058764] [ENSMUST00000129529]
Predicted Effect probably benign
Transcript: ENSMUST00000029082
SMART Domains Protein: ENSMUSP00000029082
Gene: ENSMUSG00000027566

DomainStartEndE-ValueType
Proteasome_A_N 3 25 1.84e-9 SMART
Pfam:Proteasome 26 211 1.5e-65 PFAM
low complexity region 223 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055485
AA Change: K195E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000055036
Gene: ENSMUSG00000039108
AA Change: K195E

DomainStartEndE-ValueType
LSM14 3 100 4.33e-53 SMART
low complexity region 123 142 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
FDF 247 350 3.37e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058764
AA Change: K115E

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062519
Gene: ENSMUSG00000039108
AA Change: K115E

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
low complexity region 28 44 N/A INTRINSIC
low complexity region 136 158 N/A INTRINSIC
FDF 167 270 3.37e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126021
Predicted Effect probably benign
Transcript: ENSMUST00000129529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140257
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2 G T 1: 59,196,241 S761R probably benign Het
Ankrd63 C A 2: 118,702,931 probably benign Het
Brf1 G A 12: 112,979,732 T166M probably damaging Het
C530008M17Rik A G 5: 76,858,465 N891S unknown Het
Car9 T C 4: 43,508,624 V131A possibly damaging Het
Cerk T G 15: 86,155,027 H221P possibly damaging Het
Cfap69 A T 5: 5,604,389 I458N possibly damaging Het
Chil4 T C 3: 106,214,449 Y28C probably damaging Het
Dmxl1 A G 18: 49,851,431 T165A possibly damaging Het
Erich6b A T 14: 75,658,767 N31I probably benign Het
Fgf17 G T 14: 70,641,526 probably benign Het
Fhit A T 14: 10,751,671 probably benign Het
Fnip1 A T 11: 54,502,471 I578L probably benign Het
Gm17641 C T 3: 68,869,813 R36W probably damaging Het
Gm5346 C G 8: 43,626,673 M171I probably benign Het
Gprin2 A T 14: 34,194,678 D378E probably benign Het
Grhl3 T A 4: 135,573,424 M1L probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifih1 G A 2: 62,635,190 S212L probably benign Het
Iqck T C 7: 118,941,604 I242T probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Mical1 G A 10: 41,481,176 V326I probably benign Het
Mtnr1b A T 9: 15,863,534 N76K probably damaging Het
Nalcn T C 14: 123,599,989 probably benign Het
Nop14 T C 5: 34,650,517 D367G probably benign Het
Nrxn3 T C 12: 89,533,001 C721R probably damaging Het
Olfr558 C T 7: 102,709,490 T77I probably damaging Het
Prr27 G T 5: 87,843,305 E259* probably null Het
Psmg3 G A 5: 139,826,331 P5S probably damaging Het
Pxdn A G 12: 30,003,225 T1134A probably benign Het
Rbm28 T C 6: 29,159,669 N120S probably damaging Het
Reg3b A T 6: 78,373,209 K157N possibly damaging Het
Rlf T G 4: 121,147,343 Q1480P probably damaging Het
Slc16a12 A T 19: 34,675,167 L193Q probably damaging Het
Smo G A 6: 29,759,918 R672H probably damaging Het
Smyd4 A G 11: 75,349,754 D25G probably benign Het
Sorbs2 C G 8: 45,775,595 D264E probably damaging Het
Tctn3 G T 19: 40,597,323 Q593K probably benign Het
Tdrd9 A T 12: 111,992,539 I136L possibly damaging Het
Tshz3 G A 7: 36,770,584 S666N possibly damaging Het
Ubn1 C T 16: 5,064,611 T69M probably damaging Het
Unk A T 11: 116,053,527 H368L probably benign Het
Zan A T 5: 137,437,860 L2051* probably null Het
Other mutations in Lsm14b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Lsm14b APN 2 180032626 missense probably damaging 1.00
IGL01599:Lsm14b APN 2 180032603 missense probably damaging 1.00
IGL03078:Lsm14b APN 2 180026728 missense probably damaging 1.00
PIT4283001:Lsm14b UTSW 2 180032543 missense probably benign 0.00
R1166:Lsm14b UTSW 2 180031541 unclassified probably benign
R1777:Lsm14b UTSW 2 180031795 missense probably benign 0.24
R1840:Lsm14b UTSW 2 180026728 missense probably damaging 1.00
R2095:Lsm14b UTSW 2 180031787 unclassified probably benign
R4720:Lsm14b UTSW 2 180027981 nonsense probably null
R4967:Lsm14b UTSW 2 180033899 unclassified probably benign
R5964:Lsm14b UTSW 2 180031425 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AAGCTTTCTTGGCTCAGCTG -3'
(R):5'- AAAGCTCCTGCAGAAGCCAG -3'

Sequencing Primer
(F):5'- CTTGGCTCAGCTGTTTCTAAAC -3'
(R):5'- TGCAGAAGCCAGAAGCC -3'
Posted On2015-04-30