Incidental Mutation 'R4035:Abcb8'
ID313661
Institutional Source Beutler Lab
Gene Symbol Abcb8
Ensembl Gene ENSMUSG00000028973
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 8
Synonyms
MMRRC Submission 041613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R4035 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24393663-24410054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24400621 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 168 (S168G)
Ref Sequence ENSEMBL: ENSMUSP00000110729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073076] [ENSMUST00000115077] [ENSMUST00000138168]
Predicted Effect probably benign
Transcript: ENSMUST00000073076
AA Change: S168G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072826
Gene: ENSMUSG00000028973
AA Change: S168G

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 3.6e-48 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115074
SMART Domains Protein: ENSMUSP00000110726
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115077
AA Change: S168G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110729
Gene: ENSMUSG00000028973
AA Change: S168G

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 1.1e-56 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136414
Predicted Effect probably benign
Transcript: ENSMUST00000138168
SMART Domains Protein: ENSMUSP00000119791
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000198166
AA Change: S8G
Meta Mutation Damage Score 0.1056 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Inducible cardiac specific deletion results in mild cardiomyopathy, mitochondrial defects and elevated heart mitochondrial iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,356,920 F34L probably benign Het
Ano5 A G 7: 51,566,485 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Bhlhe41 A G 6: 145,863,028 S353P probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cep350 T C 1: 155,959,795 T52A probably benign Het
Coro2b A G 9: 62,425,789 probably benign Het
Ctcf A T 8: 105,664,157 E132V possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Cxcl2 A T 5: 90,904,413 Q87L possibly damaging Het
D3Ertd254e T G 3: 36,164,840 H337Q possibly damaging Het
Dopey1 T C 9: 86,494,433 V240A probably damaging Het
Etfdh C T 3: 79,613,711 V294I probably benign Het
Fnip2 C T 3: 79,479,501 V973I probably benign Het
Fyco1 T C 9: 123,801,283 T1286A probably benign Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm13084 T A 4: 143,810,456 D435V probably benign Het
Gsdme A T 6: 50,229,448 N138K possibly damaging Het
Hcn4 A G 9: 58,843,889 D266G probably benign Het
Henmt1 T C 3: 108,958,685 V199A probably damaging Het
Hmcn2 A T 2: 31,336,612 K200* probably null Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ifi203 T A 1: 173,929,474 probably benign Het
Isl2 A G 9: 55,542,470 S119G probably benign Het
Krba1 A G 6: 48,411,680 N538D probably damaging Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Ndst4 C T 3: 125,438,736 T318M probably damaging Het
Nlrp4f T C 13: 65,194,007 N608S probably benign Het
Nolc1 GCA GCACCA 19: 46,081,358 probably benign Het
Olfr212 A G 6: 116,516,629 N284S possibly damaging Het
Olfr878 G A 9: 37,918,641 probably benign Het
Osbpl2 G A 2: 180,161,560 R475H probably damaging Het
Ppfibp1 A G 6: 146,996,836 K97E probably damaging Het
Prpsap1 A T 11: 116,473,008 M263K probably benign Het
Prtg G T 9: 72,842,709 E132* probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rttn T C 18: 88,995,653 V482A probably benign Het
Samsn1 A G 16: 75,909,185 M1T probably null Het
Scel A G 14: 103,530,004 N33S probably damaging Het
Sema4g A T 19: 45,001,414 Y644F probably damaging Het
Slc39a10 G A 1: 46,812,074 T752M probably damaging Het
Snx27 T C 3: 94,524,244 D281G probably damaging Het
Spesp1 T A 9: 62,273,036 I197L probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
Tpgs1 A G 10: 79,669,365 probably null Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ttk C A 9: 83,854,837 P450T possibly damaging Het
Ttn T G 2: 76,909,821 Q3458P probably benign Het
Ube2z A G 11: 96,061,067 F152L probably damaging Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Other mutations in Abcb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02349:Abcb8 APN 5 24406464 missense probably benign
IGL02819:Abcb8 APN 5 24406424 missense probably benign
Thumbs UTSW 5 24402103 missense probably damaging 0.99
R0320:Abcb8 UTSW 5 24400790 missense probably damaging 1.00
R0458:Abcb8 UTSW 5 24406233 missense probably benign 0.02
R0927:Abcb8 UTSW 5 24402319 missense probably damaging 1.00
R1120:Abcb8 UTSW 5 24408820 critical splice donor site probably null
R1553:Abcb8 UTSW 5 24408750 missense probably damaging 1.00
R3738:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R3739:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R4303:Abcb8 UTSW 5 24401057 missense probably damaging 1.00
R4930:Abcb8 UTSW 5 24400781 missense possibly damaging 0.89
R5369:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5370:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5485:Abcb8 UTSW 5 24400161 missense probably benign 0.01
R5505:Abcb8 UTSW 5 24401038 missense probably damaging 1.00
R5627:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5633:Abcb8 UTSW 5 24403109 missense probably damaging 1.00
R5693:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5761:Abcb8 UTSW 5 24405881 intron probably benign
R5866:Abcb8 UTSW 5 24402103 missense probably damaging 0.99
R5995:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5996:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R6621:Abcb8 UTSW 5 24394510 missense probably benign
R7407:Abcb8 UTSW 5 24400676 missense probably benign 0.00
X0026:Abcb8 UTSW 5 24401046 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACTTTTGTGACATGGATGGCC -3'
(R):5'- ATGTGGGACAGCAGCACTAG -3'

Sequencing Primer
(F):5'- TGTGGACAAGGCAAGGCTG -3'
(R):5'- CTAGGTATCCAAAGGTCAGCAGTC -3'
Posted On2015-04-30