Incidental Mutation 'R7407:Abcb8'
ID574783
Institutional Source Beutler Lab
Gene Symbol Abcb8
Ensembl Gene ENSMUSG00000028973
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R7407 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location24393663-24410054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24400676 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 186 (V186A)
Ref Sequence ENSEMBL: ENSMUSP00000072826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073076] [ENSMUST00000115077] [ENSMUST00000138168]
Predicted Effect probably benign
Transcript: ENSMUST00000073076
AA Change: V186A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072826
Gene: ENSMUSG00000028973
AA Change: V186A

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 3.6e-48 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115077
AA Change: V186A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110729
Gene: ENSMUSG00000028973
AA Change: V186A

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 1.1e-56 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138168
SMART Domains Protein: ENSMUSP00000119791
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Inducible cardiac specific deletion results in mild cardiomyopathy, mitochondrial defects and elevated heart mitochondrial iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik A G 7: 50,599,878 N220S probably damaging Het
Actbl2 A T 13: 111,256,218 E362D probably damaging Het
Adamts17 C A 7: 67,047,556 Y28* probably null Het
Agtr1b T C 3: 20,315,731 D237G possibly damaging Het
Amer2 A G 14: 60,378,842 D162G probably damaging Het
Ankub1 T C 3: 57,665,203 E366G probably benign Het
Ap5z1 A G 5: 142,466,575 I88V probably benign Het
BC053393 A G 11: 46,577,390 Y97C probably damaging Het
Ccdc186 T C 19: 56,813,385 N100S probably benign Het
Cldn19 A G 4: 119,255,685 D38G probably damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Deaf1 G A 7: 141,297,579 A545V possibly damaging Het
Dicer1 G T 12: 104,722,351 Y322* probably null Het
Dnajb7 G T 15: 81,407,626 T170K possibly damaging Het
Flrt2 A T 12: 95,779,300 E137D probably damaging Het
Galnt12 T C 4: 47,120,362 F482L probably damaging Het
Gm14025 A G 2: 129,038,809 I399T Het
Gm32742 A G 9: 51,156,674 V336A probably damaging Het
Gpatch8 G A 11: 102,479,830 R961W unknown Het
Hcn4 A G 9: 58,859,370 E738G unknown Het
Kdelr3 A G 15: 79,524,838 Y76C probably damaging Het
Krt77 T C 15: 101,860,095 S494G unknown Het
Letmd1 G T 15: 100,469,238 A39S probably benign Het
Lrrc7 G A 3: 158,135,241 R1387W probably damaging Het
Meltf T C 16: 31,894,735 Y599H probably damaging Het
Mybpc1 T A 10: 88,549,347 I477L probably damaging Het
Nf1 A G 11: 79,448,143 D1174G probably damaging Het
Olfr720 T A 14: 14,175,402 I227L probably benign Het
Olfr907 T A 9: 38,499,504 Y278* probably null Het
Palld G T 8: 61,515,941 S1283* probably null Het
Pcmtd2 T C 2: 181,846,605 V183A possibly damaging Het
Pcsk5 T A 19: 17,675,516 I269F probably damaging Het
Pkd1 T C 17: 24,594,594 L4036P probably damaging Het
Pkhd1l1 A G 15: 44,595,011 N4151S possibly damaging Het
Rcor3 C T 1: 192,101,672 S422N probably benign Het
Rhag A G 17: 40,831,334 I223V possibly damaging Het
Ssbp4 A G 8: 70,599,022 Y231H probably damaging Het
Syce1l C T 8: 113,655,138 Q237* probably null Het
Tenm4 T C 7: 96,773,987 V663A possibly damaging Het
Trim6 T C 7: 104,225,901 I115T probably damaging Het
Vmn1r25 T A 6: 57,979,059 T82S possibly damaging Het
Vmn2r28 A G 7: 5,481,309 S631P probably damaging Het
Xpo1 T A 11: 23,285,823 V637E probably damaging Het
Xpo6 A T 7: 126,171,052 M62K probably damaging Het
Ypel5 A G 17: 72,846,379 N26S possibly damaging Het
Zbtb24 C A 10: 41,464,779 Q624K possibly damaging Het
Zfp629 T C 7: 127,610,243 D798G probably benign Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Abcb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02349:Abcb8 APN 5 24406464 missense probably benign
IGL02819:Abcb8 APN 5 24406424 missense probably benign
Thumbs UTSW 5 24402103 missense probably damaging 0.99
R0320:Abcb8 UTSW 5 24400790 missense probably damaging 1.00
R0458:Abcb8 UTSW 5 24406233 missense probably benign 0.02
R0927:Abcb8 UTSW 5 24402319 missense probably damaging 1.00
R1120:Abcb8 UTSW 5 24408820 critical splice donor site probably null
R1553:Abcb8 UTSW 5 24408750 missense probably damaging 1.00
R3738:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R3739:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R4035:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R4303:Abcb8 UTSW 5 24401057 missense probably damaging 1.00
R4930:Abcb8 UTSW 5 24400781 missense possibly damaging 0.89
R5369:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5370:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5485:Abcb8 UTSW 5 24400161 missense probably benign 0.01
R5505:Abcb8 UTSW 5 24401038 missense probably damaging 1.00
R5627:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5633:Abcb8 UTSW 5 24403109 missense probably damaging 1.00
R5693:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5761:Abcb8 UTSW 5 24405881 intron probably benign
R5866:Abcb8 UTSW 5 24402103 missense probably damaging 0.99
R5995:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5996:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R6621:Abcb8 UTSW 5 24394510 missense probably benign
R8026:Abcb8 UTSW 5 24406725 missense probably damaging 1.00
R8220:Abcb8 UTSW 5 24406785 missense possibly damaging 0.70
X0026:Abcb8 UTSW 5 24401046 missense possibly damaging 0.95
Z1176:Abcb8 UTSW 5 24400995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTGTGACATGGATGGCC -3'
(R):5'- GGAGCTGAAAAGGGCTTTCC -3'

Sequencing Primer
(F):5'- TGGATACAGCCTCCTCTCCAGG -3'
(R):5'- AAAAGGGCTTTCCGCATGTC -3'
Posted On2019-10-07