Incidental Mutation 'R4115:Hat1'
ID314573
Institutional Source Beutler Lab
Gene Symbol Hat1
Ensembl Gene ENSMUSG00000027018
Gene Namehistone aminotransferase 1
Synonyms2410071B14Rik, KAT1
MMRRC Submission 041630-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R4115 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71388958-71441622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71441222 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 380 (T380A)
Ref Sequence ENSEMBL: ENSMUSP00000028408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028408] [ENSMUST00000112122]
Predicted Effect probably benign
Transcript: ENSMUST00000028408
AA Change: T380A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028408
Gene: ENSMUSG00000027018
AA Change: T380A

DomainStartEndE-ValueType
Pfam:Hat1_N 23 184 1.3e-49 PFAM
coiled coil region 386 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112122
AA Change: T387A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107750
Gene: ENSMUSG00000027018
AA Change: T387A

DomainStartEndE-ValueType
Pfam:Hat1_N 22 184 4.4e-49 PFAM
coiled coil region 393 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145147
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type B histone acetyltransferase (HAT) that is involved in the rapid acetylation of newly synthesized cytoplasmic histones, which are in turn imported into the nucleus for de novo deposition onto nascent DNA chains. Histone acetylation, particularly of histone H4, plays an important role in replication-dependent chromatin assembly. Specifically, this HAT can acetylate soluble but not nucleosomal histone H4 at lysines 5 and 12, and to a lesser degree, histone H2A at lysine 5. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal, perinatal and neonatal lethality with impaired lung maturation, atelectasis, respiratory failure, craniofacial defects and decreased proliferation of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
BC005561 T C 5: 104,519,433 L607S probably damaging Het
BC035044 C T 6: 128,890,850 probably benign Het
Camta2 T C 11: 70,676,474 M626V possibly damaging Het
Cdh7 G A 1: 110,138,309 R771Q probably benign Het
Chd3 T G 11: 69,357,517 I850L possibly damaging Het
Cspg4 T A 9: 56,898,394 L2163Q probably damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Dcun1d3 T C 7: 119,859,734 N26S probably benign Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gnl3 T G 14: 31,016,856 K79Q probably damaging Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Ighv11-1 A G 12: 113,982,065 V56A probably benign Het
Ism2 A G 12: 87,287,031 I80T probably benign Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Kif1a T A 1: 93,052,538 E823V probably damaging Het
Letm2 T A 8: 25,580,327 K432* probably null Het
Mc4r T A 18: 66,859,979 Y21F probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mycbpap C A 11: 94,512,225 probably null Het
Nfkbil1 A G 17: 35,221,310 M129T probably damaging Het
Notch3 C A 17: 32,158,433 C223F probably damaging Het
Nrcam T C 12: 44,566,326 V606A possibly damaging Het
Nudcd2 T C 11: 40,736,607 M118T probably damaging Het
Olfr341 A T 2: 36,479,785 L115Q probably damaging Het
Oraov1 G A 7: 144,919,646 V142M possibly damaging Het
Pcsk5 C T 19: 17,433,419 D1870N unknown Het
Pde3b T C 7: 114,521,727 F696L probably damaging Het
Pde8a T A 7: 81,282,807 probably null Het
Pgm2 C T 4: 99,962,151 Q191* probably null Het
Psg20 A G 7: 18,685,980 S5P probably damaging Het
Reps1 C T 10: 18,104,207 P397S possibly damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Spata13 G T 14: 60,692,478 G168V probably damaging Het
Spta1 T C 1: 174,240,357 W2117R probably damaging Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Tek T C 4: 94,849,683 S657P probably damaging Het
Trpm6 T C 19: 18,832,557 W1106R probably damaging Het
Tssk3 T C 4: 129,489,507 Y124C probably damaging Het
Ugt2b1 A G 5: 86,926,414 W29R probably damaging Het
Vmn2r97 T C 17: 18,928,070 F76L probably benign Het
Other mutations in Hat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Hat1 APN 2 71421260 missense probably damaging 1.00
IGL02945:Hat1 APN 2 71420693 missense probably benign 0.01
IGL02796:Hat1 UTSW 2 71420356 critical splice donor site probably null
R0789:Hat1 UTSW 2 71421744 splice site probably benign
R0907:Hat1 UTSW 2 71420617 nonsense probably null
R1412:Hat1 UTSW 2 71420617 nonsense probably null
R1571:Hat1 UTSW 2 71434175 missense probably benign
R1868:Hat1 UTSW 2 71421283 nonsense probably null
R1981:Hat1 UTSW 2 71389977 missense probably benign 0.01
R2064:Hat1 UTSW 2 71410160 missense possibly damaging 0.71
R2089:Hat1 UTSW 2 71434034 missense probably benign 0.12
R2091:Hat1 UTSW 2 71434034 missense probably benign 0.12
R2091:Hat1 UTSW 2 71434034 missense probably benign 0.12
R5579:Hat1 UTSW 2 71410238 missense possibly damaging 0.86
R5650:Hat1 UTSW 2 71434034 missense probably benign 0.12
R5681:Hat1 UTSW 2 71434209 splice site probably null
R5895:Hat1 UTSW 2 71409013 missense possibly damaging 0.67
R6075:Hat1 UTSW 2 71410241 missense probably benign 0.29
R6621:Hat1 UTSW 2 71421715 missense probably benign 0.00
R7155:Hat1 UTSW 2 71421251 missense possibly damaging 0.95
R7506:Hat1 UTSW 2 71420347 missense probably damaging 1.00
R7644:Hat1 UTSW 2 71410181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTATGAACTAGAGCTGAGCTGG -3'
(R):5'- AGAGGTTCACAGCACGATG -3'

Sequencing Primer
(F):5'- GCCCTCCTCTAAGCACGGTTAG -3'
(R):5'- TCCACCAGCTCCTGAAAT -3'
Posted On2015-05-14