Incidental Mutation 'R4302:Stk24'
ID322467
Institutional Source Beutler Lab
Gene Symbol Stk24
Ensembl Gene ENSMUSG00000063410
Gene Nameserine/threonine kinase 24
SynonymsSTE20, 1810013H02Rik
MMRRC Submission 041089-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4302 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location121286343-121380011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121292082 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 386 (L386S)
Ref Sequence ENSEMBL: ENSMUSP00000078746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079817]
Predicted Effect probably benign
Transcript: ENSMUST00000079817
AA Change: L386S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078746
Gene: ENSMUSG00000063410
AA Change: L386S

DomainStartEndE-ValueType
S_TKc 24 274 3.18e-99 SMART
low complexity region 297 324 N/A INTRINSIC
PDB:3W8H|B 356 422 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227273
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that functions upstream of mitogen-activated protein kinase (MAPK) signaling. The encoded protein is cleaved into two chains by caspases; the N-terminal fragment (MST3/N) translocates to the nucleus and promotes programmed cells death. There is a pseudogene for this gene on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: A hypomorphic mutation increases degranulation of, and exocytosis by, neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgef12 G A 9: 43,018,349 Q217* probably null Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Creb3l1 T C 2: 91,993,319 I183V probably damaging Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Dync2h1 A T 9: 7,077,880 S2941T probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Hcfc1 A G X: 73,949,366 S1398P probably benign Het
Igsf10 T C 3: 59,318,750 I2501V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mgam A G 6: 40,763,085 D1664G probably benign Het
Mill2 A T 7: 18,856,531 T179S probably damaging Het
Ncf4 T C 15: 78,260,762 probably benign Het
Nol12 T C 15: 78,940,141 S154P probably damaging Het
Nupl1 A G 14: 60,247,426 S50P probably benign Het
Olfr106-ps T A 17: 37,395,486 N315K probably benign Het
Olfr736 T C 14: 50,393,446 I230T probably benign Het
Olfr849 A G 9: 19,440,999 T29A probably benign Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rhpn2 A G 7: 35,390,845 T631A probably benign Het
Rps11 T C 7: 45,122,944 M80V probably benign Het
Rrm1 T C 7: 102,447,824 Y104H probably benign Het
Sgsm3 T A 15: 81,010,301 probably benign Het
Slc9c1 A T 16: 45,544,791 L162F probably benign Het
Son A G 16: 91,658,411 T1349A possibly damaging Het
Tfcp2 G T 15: 100,514,849 N307K possibly damaging Het
Trbv21 T A 6: 41,202,768 V6D probably benign Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vmn2r38 A G 7: 9,097,563 probably null Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T A 16: 21,495,914 L158Q probably damaging Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Other mutations in Stk24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Stk24 APN 14 121302806 missense probably damaging 1.00
IGL02886:Stk24 APN 14 121292115 missense probably null 1.00
IGL03278:Stk24 APN 14 121302770 missense possibly damaging 0.88
Megatron UTSW 14 121308007 splice site probably benign
R0018:Stk24 UTSW 14 121308007 splice site probably benign
R1309:Stk24 UTSW 14 121302786 missense probably damaging 0.99
R1446:Stk24 UTSW 14 121308044 missense probably damaging 1.00
R1567:Stk24 UTSW 14 121308056 missense probably benign 0.00
R1673:Stk24 UTSW 14 121337571 missense probably damaging 1.00
R2131:Stk24 UTSW 14 121302211 missense probably damaging 1.00
R4716:Stk24 UTSW 14 121294718 missense possibly damaging 0.85
R4865:Stk24 UTSW 14 121293454 nonsense probably null
R5381:Stk24 UTSW 14 121294233 missense possibly damaging 0.80
R5540:Stk24 UTSW 14 121294281 missense possibly damaging 0.69
R6017:Stk24 UTSW 14 121302245 missense probably benign 0.15
R6913:Stk24 UTSW 14 121302809 missense probably damaging 1.00
R7081:Stk24 UTSW 14 121294294 missense probably benign 0.01
R7251:Stk24 UTSW 14 121308022 missense probably damaging 1.00
R7586:Stk24 UTSW 14 121302287 missense probably damaging 0.99
R7587:Stk24 UTSW 14 121302287 missense probably damaging 0.99
R7771:Stk24 UTSW 14 121337633 missense probably damaging 1.00
RF008:Stk24 UTSW 14 121294760 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGTCTAAGAAGCCGTGCCAG -3'
(R):5'- CTGGTCTGGAAGAGTCACTG -3'

Sequencing Primer
(F):5'- GTGCCAGCACCACCAGG -3'
(R):5'- GAAGAGTCACTGTGTATGTAACTGC -3'
Posted On2015-06-20