Incidental Mutation 'R4294:Olfr1396'
ID323224
Institutional Source Beutler Lab
Gene Symbol Olfr1396
Ensembl Gene ENSMUSG00000047511
Gene Nameolfactory receptor 1396
SynonymsGA_x6K02T2QP88-6321048-6321995, MOR276-2
MMRRC Submission 041083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4294 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49109982-49114874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49113427 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 100 (I100L)
Ref Sequence ENSEMBL: ENSMUSP00000150961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000060398] [ENSMUST00000102785] [ENSMUST00000109201] [ENSMUST00000179282] [ENSMUST00000203007] [ENSMUST00000203149] [ENSMUST00000203810] [ENSMUST00000215553]
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060398
AA Change: I100L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056876
Gene: ENSMUSG00000047511
AA Change: I100L

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 3.2e-46 PFAM
Pfam:7tm_1 53 302 7.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109201
AA Change: I100L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104824
Gene: ENSMUSG00000047511
AA Change: I100L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 252 1e-5 PFAM
Pfam:7tm_1 42 291 4e-35 PFAM
Pfam:7tm_4 140 284 5.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203007
AA Change: I100L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000145057
Gene: ENSMUSG00000047511
AA Change: I100L

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 9.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 252 1e-5 PFAM
Pfam:7tm_1 42 291 3.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203149
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203412
Predicted Effect probably benign
Transcript: ENSMUST00000203810
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215553
AA Change: I100L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A T 19: 21,598,749 probably null Het
Abca3 A G 17: 24,400,569 I960M possibly damaging Het
Bivm A T 1: 44,138,633 R364S probably damaging Het
Bsnd C T 4: 106,485,158 R271H probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Clip2 A C 5: 134,492,313 V957G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dlc1 A G 8: 36,584,753 V608A possibly damaging Het
Dlg3 A T X: 100,796,682 probably benign Het
Dock3 T A 9: 106,930,043 R1362W probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gimap8 A T 6: 48,658,957 H552L probably benign Het
Gpr151 T C 18: 42,578,537 T359A probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Magel2 T G 7: 62,378,767 V473G possibly damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Nat8f1 T C 6: 85,910,655 T108A probably benign Het
Nphp3 T A 9: 104,022,717 L502Q probably damaging Het
Otud7a A G 7: 63,697,191 D171G probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Rpl27-ps3 T A 18: 6,332,607 probably null Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgsm1 A G 5: 113,285,404 Y182H probably damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Thrb C T 14: 18,011,145 Q174* probably null Het
Ticam1 A G 17: 56,271,339 I252T probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Trpv1 C T 11: 73,240,464 A276V probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r74 T A 7: 85,957,416 I241F probably benign Het
Other mutations in Olfr1396
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr1396 APN 11 49112853 missense probably damaging 1.00
IGL01514:Olfr1396 APN 11 49113576 missense probably damaging 1.00
IGL03188:Olfr1396 APN 11 49113709 missense probably damaging 1.00
R0314:Olfr1396 UTSW 11 49113692 missense possibly damaging 0.54
R1242:Olfr1396 UTSW 11 49112901 missense possibly damaging 0.95
R1625:Olfr1396 UTSW 11 49113244 missense probably benign 0.01
R2212:Olfr1396 UTSW 11 49113216 missense probably damaging 1.00
R4290:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4291:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4292:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4295:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4351:Olfr1396 UTSW 11 49113703 missense probably damaging 0.99
R4817:Olfr1396 UTSW 11 49113621 missense probably damaging 1.00
R4859:Olfr1396 UTSW 11 49113166 missense probably damaging 1.00
R5245:Olfr1396 UTSW 11 49113289 missense probably benign 0.12
R5350:Olfr1396 UTSW 11 49113052 missense probably benign 0.00
R6625:Olfr1396 UTSW 11 49113069 missense probably damaging 1.00
R7529:Olfr1396 UTSW 11 49112859 missense probably damaging 1.00
R8410:Olfr1396 UTSW 11 49113684 missense possibly damaging 0.88
R8841:Olfr1396 UTSW 11 49113111 missense probably benign 0.19
X0024:Olfr1396 UTSW 11 49113311 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGTCATTACCACTACCATCTGC -3'
(R):5'- TGGTCATGCTGGTCTTCACAG -3'

Sequencing Primer
(F):5'- TGCACCAGACCATCTGCTATC -3'
(R):5'- TGGTCTTCACAGCAGCATTG -3'
Posted On2015-06-20