Incidental Mutation 'R4294:Bivm'
ID323197
Institutional Source Beutler Lab
Gene Symbol Bivm
Ensembl Gene ENSMUSG00000041684
Gene Namebasic, immunoglobulin-like variable motif containing
Synonyms
MMRRC Submission 041083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4294 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location44118957-44144770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44138633 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 364 (R364S)
Ref Sequence ENSEMBL: ENSMUSP00000110357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035991] [ENSMUST00000114709]
Predicted Effect probably damaging
Transcript: ENSMUST00000035991
AA Change: R364S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041964
Gene: ENSMUSG00000041684
AA Change: R364S

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114709
AA Change: R364S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110357
Gene: ENSMUSG00000041684
AA Change: R364S

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Meta Mutation Damage Score 0.4728 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik A T 19: 21,598,749 probably null Het
Abca3 A G 17: 24,400,569 I960M possibly damaging Het
Bsnd C T 4: 106,485,158 R271H probably benign Het
Cckar A G 5: 53,706,497 S41P probably benign Het
Clip2 A C 5: 134,492,313 V957G probably benign Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dlc1 A G 8: 36,584,753 V608A possibly damaging Het
Dlg3 A T X: 100,796,682 probably benign Het
Dock3 T A 9: 106,930,043 R1362W probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gimap8 A T 6: 48,658,957 H552L probably benign Het
Gpr151 T C 18: 42,578,537 T359A probably benign Het
Gucy1a1 A T 3: 82,094,759 F671Y possibly damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Kif18a T C 2: 109,293,053 V224A probably benign Het
Lbr C T 1: 181,820,702 C398Y probably damaging Het
Magel2 T G 7: 62,378,767 V473G possibly damaging Het
Mapkapk3 T C 9: 107,258,932 probably benign Het
Nat8f1 T C 6: 85,910,655 T108A probably benign Het
Nphp3 T A 9: 104,022,717 L502Q probably damaging Het
Olfr1396 T A 11: 49,113,427 I100L probably benign Het
Otud7a A G 7: 63,697,191 D171G probably damaging Het
Pcdhb5 T A 18: 37,322,681 S705T possibly damaging Het
Phf14 C T 6: 11,987,097 P559S probably damaging Het
Rpl27-ps3 T A 18: 6,332,607 probably null Het
Sec16a A G 2: 26,422,155 Y1998H probably benign Het
Setd5 AT ATT 6: 113,111,320 probably benign Het
Sgsm1 A G 5: 113,285,404 Y182H probably damaging Het
Slc22a21 T C 11: 53,969,503 D34G probably damaging Het
Spata13 T A 14: 60,709,555 M684K probably damaging Het
Srsf6 T C 2: 162,934,716 probably benign Het
Thrb C T 14: 18,011,145 Q174* probably null Het
Ticam1 A G 17: 56,271,339 I252T probably benign Het
Tmem237 A G 1: 59,119,836 probably benign Het
Trpv1 C T 11: 73,240,464 A276V probably damaging Het
Vmn1r192 T A 13: 22,187,295 I252F probably damaging Het
Vmn2r74 T A 7: 85,957,416 I241F probably benign Het
Other mutations in Bivm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Bivm APN 1 44129291 missense probably damaging 1.00
IGL01384:Bivm APN 1 44126747 missense possibly damaging 0.86
IGL01552:Bivm APN 1 44126773 missense probably benign 0.40
IGL01736:Bivm APN 1 44141813 missense probably damaging 1.00
IGL02332:Bivm APN 1 44128720 unclassified probably benign
IGL02704:Bivm APN 1 44126446 missense probably benign
IGL02859:Bivm APN 1 44136999 nonsense probably null
IGL02939:Bivm APN 1 44142960 missense probably benign 0.03
IGL03265:Bivm APN 1 44141845 missense probably damaging 1.00
R0456:Bivm UTSW 1 44126809 missense probably damaging 1.00
R1172:Bivm UTSW 1 44126782 missense probably benign 0.04
R1173:Bivm UTSW 1 44126782 missense probably benign 0.04
R1174:Bivm UTSW 1 44126782 missense probably benign 0.04
R1177:Bivm UTSW 1 44142963 missense probably benign 0.28
R1350:Bivm UTSW 1 44126703 missense possibly damaging 0.88
R1611:Bivm UTSW 1 44126747 missense possibly damaging 0.92
R2518:Bivm UTSW 1 44129615 missense probably damaging 0.96
R3735:Bivm UTSW 1 44126434 missense probably benign 0.07
R4290:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4292:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4293:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4849:Bivm UTSW 1 44142873 missense possibly damaging 0.70
R5204:Bivm UTSW 1 44138578 missense probably damaging 0.96
R5912:Bivm UTSW 1 44126413 nonsense probably null
R6045:Bivm UTSW 1 44119073 start gained probably benign
R6216:Bivm UTSW 1 44126868 critical splice donor site probably null
R6836:Bivm UTSW 1 44143136 missense possibly damaging 0.88
R7120:Bivm UTSW 1 44126446 missense probably benign
R7817:Bivm UTSW 1 44126401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGGATTCCTAGAATGGGACC -3'
(R):5'- AGAACTTTCTGTGGCAAGACTG -3'

Sequencing Primer
(F):5'- GGGACCAAACCTAAGTGCTCATATTG -3'
(R):5'- CTGTGGCAAGACTGTACATAGTAC -3'
Posted On2015-06-20