Incidental Mutation 'R4361:1700003E16Rik'
ID324909
Institutional Source Beutler Lab
Gene Symbol 1700003E16Rik
Ensembl Gene ENSMUSG00000030030
Gene NameRIKEN cDNA 1700003E16 gene
Synonyms
MMRRC Submission 041112-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R4361 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83156404-83162945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83162706 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 538 (T538A)
Ref Sequence ENSEMBL: ENSMUSP00000032106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032106] [ENSMUST00000077407] [ENSMUST00000113913] [ENSMUST00000130212] [ENSMUST00000203203]
Predicted Effect probably damaging
Transcript: ENSMUST00000032106
AA Change: T538A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032106
Gene: ENSMUSG00000030030
AA Change: T538A

DomainStartEndE-ValueType
Pfam:DUF4639 6 571 3.7e-266 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077407
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113913
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130212
SMART Domains Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154953
Predicted Effect probably benign
Transcript: ENSMUST00000203203
SMART Domains Protein: ENSMUSP00000145406
Gene: ENSMUSG00000030030

DomainStartEndE-ValueType
Pfam:DUF4639 6 82 1.4e-52 PFAM
low complexity region 90 107 N/A INTRINSIC
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik A G 7: 4,151,780 V3A possibly damaging Het
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Aadac T A 3: 60,039,761 S293R probably benign Het
Cc2d1b G A 4: 108,624,750 probably benign Het
Ccdc157 C T 11: 4,146,550 A400T probably damaging Het
Cyp11b1 T A 15: 74,839,016 M232L possibly damaging Het
Dhrs2 G A 14: 55,241,189 D264N probably damaging Het
Dram2 T C 3: 106,566,215 probably benign Het
Dtx4 C A 19: 12,485,296 S373I probably benign Het
Eif4a1 G A 11: 69,667,464 probably benign Het
Eps15 T C 4: 109,380,031 probably null Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam135b T A 15: 71,490,827 Q235L probably damaging Het
Fgfr3 T C 5: 33,723,332 probably benign Het
Gabra4 C T 5: 71,633,545 probably null Het
Gins1 A G 2: 150,925,901 Y117C probably damaging Het
Gm12253 T A 11: 58,434,861 S53T probably benign Het
Gm884 CTTTT CTTTTT 11: 103,617,501 probably null Het
Gne C A 4: 44,059,947 A149S possibly damaging Het
Gpc2 A T 5: 138,278,290 C191* probably null Het
Has2 G T 15: 56,681,948 A86E probably damaging Het
Ift80 A T 3: 68,963,649 S205T probably damaging Het
Irx5 G T 8: 92,358,397 A72S probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kcnt1 A T 2: 25,878,032 Q51L probably benign Het
Klk1b11 A G 7: 43,995,954 probably null Het
Kmt2d T G 15: 98,863,670 M600L unknown Het
Lmtk2 T A 5: 144,147,664 S172R probably damaging Het
Lrrc46 G A 11: 97,034,670 probably benign Het
Mab21l2 C T 3: 86,547,190 V168M probably damaging Het
Magea3 C A X: 154,948,853 C218F probably benign Het
Magea3 A C X: 154,948,854 C218G possibly damaging Het
Man1a2 T C 3: 100,656,042 K96E probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myf6 GGGGGCAG GG 10: 107,494,432 probably benign Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nav1 G A 1: 135,607,437 probably benign Het
Nav3 T C 10: 109,852,986 K477E probably damaging Het
Nup98 T A 7: 102,145,714 H862L probably damaging Het
Pcnx2 G T 8: 125,768,298 S1608* probably null Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Ren1 A G 1: 133,359,041 I303V probably benign Het
Retreg3 T A 11: 101,103,887 probably null Het
Rnf6 C A 5: 146,211,279 V310F probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scrn2 C T 11: 97,032,238 A169V probably null Het
Slc4a10 T C 2: 62,243,385 S264P probably benign Het
Tex26 A T 5: 149,460,923 Q102L probably benign Het
Tex38 A G 4: 115,780,223 S128P probably benign Het
Trmt1l A G 1: 151,435,875 probably benign Het
Tyr G T 7: 87,429,076 H525Q probably benign Het
Veph1 T C 3: 66,159,316 N417S probably benign Het
Zfp597 A T 16: 3,865,900 S331T probably damaging Het
Other mutations in 1700003E16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:1700003E16Rik APN 6 83162788 splice site probably null
IGL02616:1700003E16Rik APN 6 83161662 missense probably benign
IGL03171:1700003E16Rik APN 6 83162395 missense possibly damaging 0.73
IGL03196:1700003E16Rik APN 6 83161063 missense probably damaging 1.00
R0124:1700003E16Rik UTSW 6 83161674 missense probably benign
R1081:1700003E16Rik UTSW 6 83162020 missense probably benign
R1184:1700003E16Rik UTSW 6 83160912 missense probably damaging 1.00
R1522:1700003E16Rik UTSW 6 83162586 missense probably damaging 0.96
R4688:1700003E16Rik UTSW 6 83162698 missense probably damaging 0.99
R5326:1700003E16Rik UTSW 6 83161354 missense probably damaging 0.99
R6007:1700003E16Rik UTSW 6 83160918 missense possibly damaging 0.80
R7212:1700003E16Rik UTSW 6 83161672 missense probably benign 0.00
R7343:1700003E16Rik UTSW 6 83162371 missense probably benign 0.12
R8081:1700003E16Rik UTSW 6 83161331 missense probably damaging 1.00
R8121:1700003E16Rik UTSW 6 83161911 missense probably benign
Z1176:1700003E16Rik UTSW 6 83161115 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCCCCTAGCTAAGTGG -3'
(R):5'- ATTTCCCAGTGTGGAGGCTC -3'

Sequencing Primer
(F):5'- CCTAGCTAAGTGGCCAAGTG -3'
(R):5'- CAGTGTGGAGGCTCAGGAC -3'
Posted On2015-07-06