Incidental Mutation 'R8081:1700003E16Rik'
ID629335
Institutional Source Beutler Lab
Gene Symbol 1700003E16Rik
Ensembl Gene ENSMUSG00000030030
Gene NameRIKEN cDNA 1700003E16 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R8081 (G1)
Quality Score219.009
Status Not validated
Chromosome6
Chromosomal Location83156404-83162945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83161331 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 119 (E119V)
Ref Sequence ENSEMBL: ENSMUSP00000032106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032106] [ENSMUST00000077407] [ENSMUST00000113913] [ENSMUST00000125894] [ENSMUST00000130212] [ENSMUST00000153148] [ENSMUST00000203203]
Predicted Effect probably damaging
Transcript: ENSMUST00000032106
AA Change: E119V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032106
Gene: ENSMUSG00000030030
AA Change: E119V

DomainStartEndE-ValueType
Pfam:DUF4639 6 571 3.7e-266 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077407
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113913
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125894
SMART Domains Protein: ENSMUSP00000122873
Gene: ENSMUSG00000030032

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130212
SMART Domains Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153148
SMART Domains Protein: ENSMUSP00000116608
Gene: ENSMUSG00000030032

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
WD40 153 197 5.92e1 SMART
WD40 201 238 3.55e1 SMART
WD40 241 280 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203203
SMART Domains Protein: ENSMUSP00000145406
Gene: ENSMUSG00000030030

DomainStartEndE-ValueType
Pfam:DUF4639 6 82 1.4e-52 PFAM
low complexity region 90 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A T 11: 50,777,177 D522V probably damaging Het
Agtpbp1 A T 13: 59,528,407 L183* probably null Het
Arhgap10 T C 8: 77,382,746 I403V possibly damaging Het
Arhgef11 T C 3: 87,725,642 S687P probably damaging Het
Cdhr1 C T 14: 37,094,010 V144I probably benign Het
Cdk20 A G 13: 64,438,952 I339V probably benign Het
Ceacam13 A G 7: 18,013,188 K189E probably damaging Het
Cep290 C T 10: 100,558,176 Q2082* probably null Het
Cgrrf1 A G 14: 46,854,011 T331A probably benign Het
Cntn4 G A 6: 106,674,607 V706I possibly damaging Het
Csrnp2 T C 15: 100,489,581 D2G probably damaging Het
Cux2 A G 5: 121,869,456 I714T probably benign Het
Cx3cr1 C T 9: 120,051,812 E175K possibly damaging Het
Dennd1c G A 17: 57,074,139 P163L possibly damaging Het
Dhtkd1 C T 2: 5,924,108 E251K probably damaging Het
Epas1 C T 17: 86,829,369 P787S probably benign Het
Epha2 T C 4: 141,322,294 V737A probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fscb A T 12: 64,472,028 M888K unknown Het
Fuk T A 8: 110,889,151 R515S probably benign Het
Gldc ACGACC AC 19: 30,158,587 probably null Het
Gm14443 A T 2: 175,170,445 C69* probably null Het
Gm19668 G A 10: 77,798,586 A183V unknown Het
Gm49368 A G 7: 128,127,108 R1231G unknown Het
Grin2c T C 11: 115,249,893 Y1133C probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hydin T C 8: 110,365,469 S425P possibly damaging Het
Ifnl3 T C 7: 28,524,257 S173P probably damaging Het
Igkv4-63 A T 6: 69,378,034 S88T possibly damaging Het
Klhl5 C A 5: 65,162,925 N607K possibly damaging Het
Lag3 A T 6: 124,905,447 L362* probably null Het
Lats2 C A 14: 57,700,511 G174C probably damaging Het
Mcm6 T C 1: 128,338,168 E622G probably damaging Het
Med13l C A 5: 118,728,268 H462Q probably damaging Het
Mrpl53 T A 6: 83,109,178 F23I probably damaging Het
Muc5b T G 7: 141,864,006 I3563S possibly damaging Het
Myo16 A C 8: 10,322,743 L147F unknown Het
Npc1l1 G C 11: 6,217,768 Q1008E probably benign Het
Npy4r A G 14: 34,146,567 S255P probably damaging Het
Nup210 T C 6: 91,076,675 N287D probably benign Het
Olfr1021-ps1 C T 2: 85,863,495 P28L probably damaging Het
Olfr1126 G T 2: 87,457,169 M1I probably null Het
Olfr530 A T 7: 140,373,059 L184M probably damaging Het
Olfr536 A T 7: 140,504,456 M1K probably null Het
Olfr730 T A 14: 50,186,368 N284I probably damaging Het
Opn3 T A 1: 175,665,569 H143L probably damaging Het
Pdcd7 C T 9: 65,346,685 R182C probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Picalm T A 7: 90,191,243 L540* probably null Het
Ppp1r21 T A 17: 88,558,844 I356N probably damaging Het
Rgs6 C T 12: 83,047,573 Q67* probably null Het
Ripor2 C A 13: 24,713,700 Q794K probably benign Het
Rnf216 A T 5: 143,027,964 I702N probably damaging Het
Robo4 T C 9: 37,405,640 L417P probably damaging Het
Samhd1 A T 2: 157,101,438 C605* probably null Het
Scaper C T 9: 55,916,046 G22D unknown Het
Senp5 T C 16: 31,965,759 T692A probably damaging Het
Six6 G T 12: 72,940,101 G16W probably damaging Het
Slc38a8 A T 8: 119,485,530 M358K possibly damaging Het
Snx2 T C 18: 53,216,387 F407L probably benign Het
Srrm2 T A 17: 23,820,245 N1954K probably damaging Het
Syk A T 13: 52,638,159 M429L probably benign Het
Tln2 T A 9: 67,356,747 N537Y probably damaging Het
Usp29 T A 7: 6,963,630 M824K probably benign Het
Utrn A G 10: 12,548,059 probably benign Het
Wdr37 C T 13: 8,835,370 D346N probably damaging Het
Zfpm2 T A 15: 41,102,248 C710S probably damaging Het
Other mutations in 1700003E16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:1700003E16Rik APN 6 83162788 splice site probably null
IGL02616:1700003E16Rik APN 6 83161662 missense probably benign
IGL03171:1700003E16Rik APN 6 83162395 missense possibly damaging 0.73
IGL03196:1700003E16Rik APN 6 83161063 missense probably damaging 1.00
R0124:1700003E16Rik UTSW 6 83161674 missense probably benign
R1081:1700003E16Rik UTSW 6 83162020 missense probably benign
R1184:1700003E16Rik UTSW 6 83160912 missense probably damaging 1.00
R1522:1700003E16Rik UTSW 6 83162586 missense probably damaging 0.96
R4361:1700003E16Rik UTSW 6 83162706 missense probably damaging 0.99
R4688:1700003E16Rik UTSW 6 83162698 missense probably damaging 0.99
R5326:1700003E16Rik UTSW 6 83161354 missense probably damaging 0.99
R6007:1700003E16Rik UTSW 6 83160918 missense possibly damaging 0.80
R7212:1700003E16Rik UTSW 6 83161672 missense probably benign 0.00
R7343:1700003E16Rik UTSW 6 83162371 missense probably benign 0.12
R8121:1700003E16Rik UTSW 6 83161911 missense probably benign
Z1176:1700003E16Rik UTSW 6 83161115 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTCTATCTGACCCAGCAGG -3'
(R):5'- GGAAAGGACCTCACTTCGTG -3'

Sequencing Primer
(F):5'- GGCCTAGATCTGGGTCTTCC -3'
(R):5'- TCACTTCGTGGTCCTGAGCG -3'
Posted On2020-06-30