Incidental Mutation 'R1081:1700003E16Rik'
ID152689
Institutional Source Beutler Lab
Gene Symbol 1700003E16Rik
Ensembl Gene ENSMUSG00000030030
Gene NameRIKEN cDNA 1700003E16 gene
Synonyms
MMRRC Submission 039167-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R1081 (G1)
Quality Score161
Status Not validated
Chromosome6
Chromosomal Location83156404-83162945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83162020 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 309 (E309G)
Ref Sequence ENSEMBL: ENSMUSP00000032106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032106] [ENSMUST00000077407] [ENSMUST00000113913] [ENSMUST00000130212] [ENSMUST00000203203]
Predicted Effect probably benign
Transcript: ENSMUST00000032106
AA Change: E309G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032106
Gene: ENSMUSG00000030030
AA Change: E309G

DomainStartEndE-ValueType
Pfam:DUF4639 6 571 3.7e-266 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077407
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113913
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130212
SMART Domains Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154953
Predicted Effect probably benign
Transcript: ENSMUST00000203203
SMART Domains Protein: ENSMUSP00000145406
Gene: ENSMUSG00000030030

DomainStartEndE-ValueType
Pfam:DUF4639 6 82 1.4e-52 PFAM
low complexity region 90 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr T C 11: 76,455,615 K448E probably damaging Het
Atxn2l T C 7: 126,494,212 Y785C probably damaging Het
Atxn3 T G 12: 101,934,349 D225A probably damaging Het
BC049730 T C 7: 24,713,542 probably null Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Cntnap5c A G 17: 58,305,525 D853G possibly damaging Het
Dnah9 A G 11: 66,084,877 Y1449H probably damaging Het
Dsc2 T G 18: 20,033,295 T760P probably damaging Het
Dync2h1 A T 9: 7,005,488 probably null Het
Epg5 T C 18: 77,959,533 F611L possibly damaging Het
Fat3 T C 9: 16,375,284 D981G possibly damaging Het
Gimap3 A T 6: 48,765,152 C281* probably null Het
Ids T C X: 70,361,110 D149G possibly damaging Het
Inpp4b A G 8: 82,069,024 I826V probably damaging Het
Kcnrg C A 14: 61,607,714 H68N possibly damaging Het
Klra6 A G 6: 130,022,625 Y127H probably damaging Het
Mepce A G 5: 137,784,696 L456P probably damaging Het
Mink1 T C 11: 70,607,035 L488P probably benign Het
Mndal T A 1: 173,860,222 E482V probably benign Het
Mob1b G A 5: 88,753,162 V143I probably benign Het
Msh4 T C 3: 153,872,358 E433G probably benign Het
Myof A T 19: 37,986,088 I201N probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ntsr1 G A 2: 180,538,756 S285N probably benign Het
Olfr319 C T 11: 58,702,498 H266Y probably damaging Het
Olfr598 A G 7: 103,329,038 Y184C probably damaging Het
Olfr66 T A 7: 103,882,177 H22L possibly damaging Het
Olfr730 A G 14: 50,187,197 S7P probably damaging Het
P2rx4 A G 5: 122,727,233 E307G probably damaging Het
Pcdh15 A G 10: 74,450,313 D793G probably damaging Het
Rpap1 G A 2: 119,771,269 R737W probably damaging Het
Rpusd4 A G 9: 35,275,088 K307E probably benign Het
Shtn1 T A 19: 58,975,015 T623S probably benign Het
Sntg1 A G 1: 8,445,119 C397R possibly damaging Het
Stat5a T C 11: 100,881,060 F646S probably damaging Het
Tacc2 A G 7: 130,728,574 E196G possibly damaging Het
Tcf25 T C 8: 123,381,473 V89A probably benign Het
Trim7 G T 11: 48,849,705 V210L probably damaging Het
Vmn2r57 A G 7: 41,428,211 M177T possibly damaging Het
Wwc2 G A 8: 47,828,764 probably benign Het
Zfp28 A G 7: 6,389,780 I152V possibly damaging Het
Zfp628 A G 7: 4,920,183 H468R probably damaging Het
Zfp770 A G 2: 114,197,127 Y154H probably damaging Het
Other mutations in 1700003E16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:1700003E16Rik APN 6 83162788 splice site probably null
IGL02616:1700003E16Rik APN 6 83161662 missense probably benign
IGL03171:1700003E16Rik APN 6 83162395 missense possibly damaging 0.73
IGL03196:1700003E16Rik APN 6 83161063 missense probably damaging 1.00
R0124:1700003E16Rik UTSW 6 83161674 missense probably benign
R1184:1700003E16Rik UTSW 6 83160912 missense probably damaging 1.00
R1522:1700003E16Rik UTSW 6 83162586 missense probably damaging 0.96
R4361:1700003E16Rik UTSW 6 83162706 missense probably damaging 0.99
R4688:1700003E16Rik UTSW 6 83162698 missense probably damaging 0.99
R5326:1700003E16Rik UTSW 6 83161354 missense probably damaging 0.99
R6007:1700003E16Rik UTSW 6 83160918 missense possibly damaging 0.80
R7212:1700003E16Rik UTSW 6 83161672 missense probably benign 0.00
R7343:1700003E16Rik UTSW 6 83162371 missense probably benign 0.12
R8081:1700003E16Rik UTSW 6 83161331 missense probably damaging 1.00
R8121:1700003E16Rik UTSW 6 83161911 missense probably benign
Z1176:1700003E16Rik UTSW 6 83161115 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGAAGCAGCCCCAAGTAGTC -3'
(R):5'- AGCACGGAATGTAGCACAACGC -3'

Sequencing Primer
(F):5'- CCAAGTAGTCCGTCTTCAGG -3'
(R):5'- CCTTGGGCTAGAGACATGG -3'
Posted On2014-01-29