Incidental Mutation 'R4383:Ermard'
ID325420
Institutional Source Beutler Lab
Gene Symbol Ermard
Ensembl Gene ENSMUSG00000036552
Gene NameER membrane associated RNA degradation
Synonyms2410011O22Rik, 2210404J11Rik
MMRRC Submission 041123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4383 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15041208-15090044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15059866 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 130 (S130P)
Ref Sequence ENSEMBL: ENSMUSP00000154319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040594] [ENSMUST00000097393] [ENSMUST00000227252] [ENSMUST00000228803]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040594
AA Change: S93P

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043677
Gene: ENSMUSG00000036552
AA Change: S93P

DomainStartEndE-ValueType
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097393
AA Change: S541P

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095005
Gene: ENSMUSG00000036552
AA Change: S541P

DomainStartEndE-ValueType
Pfam:DUF4209 133 214 3.1e-27 PFAM
low complexity region 390 399 N/A INTRINSIC
SCOP:g1pnb.1 429 478 4e-3 SMART
low complexity region 583 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187199
Predicted Effect probably benign
Transcript: ENSMUST00000227252
Predicted Effect possibly damaging
Transcript: ENSMUST00000228803
AA Change: S130P

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231568
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 89% (32/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains 2 transmembrane domains near the C-terminus and is localized in the endoplasmic reticulum. Knockout of this gene in developing rat brain showed that it may be involved in neuronal migration. Mutations in this gene are associated with periventricular nodular heterotopia-6 (PVNH6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arih2 T G 9: 108,644,277 M1L probably benign Het
Asic3 A G 5: 24,413,934 T75A probably damaging Het
Baat C T 4: 49,499,731 A192T probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Clca3a2 T C 3: 144,806,320 I552V probably benign Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Des T C 1: 75,360,769 F118L possibly damaging Het
Fbxl5 A G 5: 43,762,963 probably benign Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Inmt C A 6: 55,171,218 C142F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kmt2c A T 5: 25,351,062 D1228E possibly damaging Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Msh2 G A 17: 87,689,138 E425K probably benign Het
Olfr430 T C 1: 174,069,477 Y60H probably benign Het
Poc1b A G 10: 99,156,299 D326G probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rsf1 A G 7: 97,685,476 K1272R possibly damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Trim3 C T 7: 105,618,399 A264T probably damaging Het
Ubr2 G C 17: 46,939,387 H1545D probably benign Het
Vps13a A T 19: 16,701,165 C1151S probably damaging Het
Zap70 C T 1: 36,780,961 R471W probably damaging Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp606 A T 7: 12,494,001 Y625F probably damaging Het
Other mutations in Ermard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ermard APN 17 14988066 splice site probably benign
IGL01554:Ermard APN 17 15051593 missense possibly damaging 0.94
IGL01832:Ermard APN 17 15059849 missense probably damaging 0.98
IGL02045:Ermard APN 17 15051564 unclassified probably benign
IGL02332:Ermard APN 17 14990545 critical splice acceptor site probably null
IGL02525:Ermard APN 17 15059339 splice site probably benign
IGL03335:Ermard APN 17 15059406 missense probably damaging 1.00
Eminence UTSW 17 15053205 splice site probably null
PIT4504001:Ermard UTSW 17 15058822 nonsense probably null
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0722:Ermard UTSW 17 15022128 missense probably benign 0.13
R0785:Ermard UTSW 17 15021977 missense probably damaging 1.00
R2019:Ermard UTSW 17 15053265 missense probably damaging 1.00
R3696:Ermard UTSW 17 15053376 missense probably benign 0.01
R3697:Ermard UTSW 17 15053376 missense probably benign 0.01
R4077:Ermard UTSW 17 15053376 missense probably benign 0.04
R5424:Ermard UTSW 17 15059770 missense possibly damaging 0.73
R6313:Ermard UTSW 17 15053205 splice site probably null
R7685:Ermard UTSW 17 15059462 missense probably benign 0.00
R7800:Ermard UTSW 17 15056803 missense probably benign 0.01
R7802:Ermard UTSW 17 15061161 missense probably benign
R7895:Ermard UTSW 17 15063613 missense possibly damaging 0.66
R7978:Ermard UTSW 17 15063613 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GCATTTTACCTGCCGGTCAC -3'
(R):5'- CACTGTAACTACTCTCTGAAAGGG -3'

Sequencing Primer
(F):5'- TCACTTGCTGAGGTGCCAC -3'
(R):5'- CTGCCTTGAACGTAACCT -3'
Posted On2015-07-06