Incidental Mutation 'R4396:Mtus2'
ID325480
Institutional Source Beutler Lab
Gene Symbol Mtus2
Ensembl Gene ENSMUSG00000029651
Gene Namemicrotubule associated tumor suppressor candidate 2
Synonyms
MMRRC Submission 041129-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R4396 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147957320-148316065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148203938 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 871 (N871K)
Ref Sequence ENSEMBL: ENSMUSP00000082694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085558]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085558
AA Change: N871K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082694
Gene: ENSMUSG00000029651
AA Change: N871K

DomainStartEndE-ValueType
internal_repeat_1 57 290 2.46e-5 PROSPERO
internal_repeat_1 312 525 2.46e-5 PROSPERO
low complexity region 530 541 N/A INTRINSIC
low complexity region 802 818 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
coiled coil region 1029 1080 N/A INTRINSIC
SCOP:d1fxkc_ 1167 1294 3e-4 SMART
low complexity region 1332 1349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200900
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T C 7: 119,595,920 F552L probably damaging Het
Actn2 A G 13: 12,310,879 L70P probably damaging Het
Btbd7 A G 12: 102,785,293 S1071P probably benign Het
Cd200r1 T A 16: 44,766,054 W16R probably benign Het
Cdhr2 A G 13: 54,715,665 N120D probably damaging Het
Col19a1 T C 1: 24,510,866 T317A unknown Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 T C 7: 131,116,632 L1683P probably damaging Het
Dynll1 A T 5: 115,300,641 C2S probably benign Het
Elp2 T A 18: 24,609,650 S80T probably damaging Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fzd3 A G 14: 65,235,605 I238T probably damaging Het
Galnt7 A T 8: 57,538,181 F432I probably damaging Het
Gemin5 T A 11: 58,139,549 T817S probably benign Het
Gm5414 T G 15: 101,625,666 E294A probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Kcnj4 C A 15: 79,484,673 A369S probably benign Het
Llgl1 T C 11: 60,706,008 V145A probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mettl2 A G 11: 105,126,778 D38G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mpp4 T C 1: 59,144,802 I260V possibly damaging Het
Mtcl1 T C 17: 66,344,225 E1112G probably damaging Het
Mylk C T 16: 34,912,275 Q642* probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Olfr1308 A G 2: 111,960,215 I286T probably damaging Het
Pdzd2 A T 15: 12,387,646 D875E probably benign Het
Piezo1 G T 8: 122,498,674 T557K probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxnb1 T C 9: 109,100,223 V49A possibly damaging Het
Pramel6 A T 2: 87,508,530 I25F probably damaging Het
Rreb1 C T 13: 37,930,443 Q593* probably null Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Scnn1g T G 7: 121,740,427 S150A probably benign Het
Sec24a A G 11: 51,715,164 F686L possibly damaging Het
Sirt1 T C 10: 63,321,998 T546A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Traf5 A T 1: 191,997,845 V415E probably benign Het
Traip C G 9: 107,959,487 T110S probably benign Het
Treml2 T C 17: 48,308,114 V209A probably benign Het
Trpv5 T C 6: 41,657,896 S500G probably benign Het
Usp32 G A 11: 85,053,975 L296F probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Zswim1 A G 2: 164,825,449 D207G probably damaging Het
Other mutations in Mtus2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Mtus2 APN 5 148077009 unclassified probably null
IGL01911:Mtus2 APN 5 148078220 missense probably benign 0.00
IGL01973:Mtus2 APN 5 148303476 splice site probably benign
IGL02452:Mtus2 APN 5 148077663 missense probably benign 0.01
IGL02476:Mtus2 APN 5 148077938 missense probably benign 0.01
IGL02716:Mtus2 APN 5 148236310 missense probably benign 0.05
IGL03194:Mtus2 APN 5 148107103 missense probably damaging 1.00
rumblado UTSW 5 148306708 nonsense probably null
IGL02991:Mtus2 UTSW 5 148313500 missense probably damaging 1.00
PIT4431001:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0310:Mtus2 UTSW 5 148107019 missense probably benign 0.17
R0729:Mtus2 UTSW 5 148077287 missense probably benign 0.08
R0968:Mtus2 UTSW 5 148078184 missense probably benign 0.09
R1231:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1253:Mtus2 UTSW 5 148303570 nonsense probably null
R1556:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1561:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1574:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1750:Mtus2 UTSW 5 148277633 missense probably damaging 0.97
R2318:Mtus2 UTSW 5 148107082 nonsense probably null
R2327:Mtus2 UTSW 5 148077915 missense probably benign 0.00
R3153:Mtus2 UTSW 5 148083060 missense probably damaging 1.00
R3154:Mtus2 UTSW 5 148303273 intron probably benign
R3158:Mtus2 UTSW 5 148231827 missense probably damaging 1.00
R3548:Mtus2 UTSW 5 148295506 missense probably damaging 1.00
R3861:Mtus2 UTSW 5 148313413 missense probably damaging 1.00
R4395:Mtus2 UTSW 5 148076622 missense probably benign 0.17
R4667:Mtus2 UTSW 5 148298260 missense possibly damaging 0.64
R4887:Mtus2 UTSW 5 148077103 nonsense probably null
R4931:Mtus2 UTSW 5 148077416 missense probably benign 0.09
R5097:Mtus2 UTSW 5 148295582 missense probably damaging 0.99
R5318:Mtus2 UTSW 5 148076572 missense probably benign 0.05
R5372:Mtus2 UTSW 5 148313412 missense probably damaging 1.00
R5388:Mtus2 UTSW 5 148306708 nonsense probably null
R5622:Mtus2 UTSW 5 148078434 missense probably benign 0.09
R6009:Mtus2 UTSW 5 148306652 missense probably damaging 1.00
R6379:Mtus2 UTSW 5 148077198 missense probably benign 0.00
R6409:Mtus2 UTSW 5 148077615 missense probably benign
R6527:Mtus2 UTSW 5 148277598 critical splice acceptor site probably null
R6853:Mtus2 UTSW 5 148107011 missense probably damaging 1.00
R7001:Mtus2 UTSW 5 148277628 missense probably damaging 1.00
R7187:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R7276:Mtus2 UTSW 5 148076558 missense probably benign
R7594:Mtus2 UTSW 5 148077406 missense probably benign 0.44
R7790:Mtus2 UTSW 5 148078188 missense probably benign 0.09
X0017:Mtus2 UTSW 5 148277600 missense possibly damaging 0.83
X0028:Mtus2 UTSW 5 148077318 missense probably benign 0.03
Z1088:Mtus2 UTSW 5 148303263 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATGACAGACATTTAGGTCATTGACC -3'
(R):5'- AAAGGCTACTCCACTGTGGC -3'

Sequencing Primer
(F):5'- GAAGGTCTTTCCACATCTATTTCCAG -3'
(R):5'- CGCTCCTGGAAGGCAGAAG -3'
Posted On2015-07-06