Incidental Mutation 'R1253:Mtus2'
ID151839
Institutional Source Beutler Lab
Gene Symbol Mtus2
Ensembl Gene ENSMUSG00000029651
Gene Namemicrotubule associated tumor suppressor candidate 2
Synonyms
MMRRC Submission 039320-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R1253 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location147957320-148316065 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 148303570 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 76 (Q76*)
Ref Sequence ENSEMBL: ENSMUSP00000123055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071878] [ENSMUST00000085554] [ENSMUST00000085558] [ENSMUST00000110514] [ENSMUST00000110515] [ENSMUST00000146425] [ENSMUST00000152105]
Predicted Effect unknown
Transcript: ENSMUST00000071878
AA Change: A177V
SMART Domains Protein: ENSMUSP00000071775
Gene: ENSMUSG00000029651
AA Change: A177V

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085554
AA Change: Q39*
SMART Domains Protein: ENSMUSP00000082690
Gene: ENSMUSG00000029651
AA Change: Q39*

DomainStartEndE-ValueType
coiled coil region 15 118 N/A INTRINSIC
low complexity region 131 148 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085558
AA Change: Q1240*
SMART Domains Protein: ENSMUSP00000082694
Gene: ENSMUSG00000029651
AA Change: Q1240*

DomainStartEndE-ValueType
internal_repeat_1 57 290 2.46e-5 PROSPERO
internal_repeat_1 312 525 2.46e-5 PROSPERO
low complexity region 530 541 N/A INTRINSIC
low complexity region 802 818 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
coiled coil region 1029 1080 N/A INTRINSIC
SCOP:d1fxkc_ 1167 1294 3e-4 SMART
low complexity region 1332 1349 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110514
AA Change: Q202*
SMART Domains Protein: ENSMUSP00000106143
Gene: ENSMUSG00000029651
AA Change: Q202*

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
coiled coil region 144 281 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110515
AA Change: Q235*
SMART Domains Protein: ENSMUSP00000106144
Gene: ENSMUSG00000029651
AA Change: Q235*

DomainStartEndE-ValueType
coiled coil region 19 75 N/A INTRINSIC
coiled coil region 144 314 N/A INTRINSIC
low complexity region 327 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146425
Predicted Effect probably null
Transcript: ENSMUST00000152105
AA Change: Q76*
SMART Domains Protein: ENSMUSP00000123055
Gene: ENSMUSG00000029651
AA Change: Q76*

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
coiled coil region 52 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 G A 6: 83,522,887 T127I probably damaging Het
Aph1b T A 9: 66,790,649 K102* probably null Het
Caskin1 A G 17: 24,505,073 K945R probably damaging Het
Ccdc137 C A 11: 120,458,179 A12E probably benign Het
Cdhr1 A G 14: 37,079,625 M787T probably benign Het
Cic T A 7: 25,290,948 V1958E probably damaging Het
Col6a6 T A 9: 105,774,303 I1170F probably null Het
Cyp2c54 T A 19: 40,046,185 Y347F probably damaging Het
Kntc1 AGTGT AGT 5: 123,810,862 probably null Het
Large1 T C 8: 73,048,422 Y220C probably damaging Het
Macf1 A T 4: 123,457,967 D1592E probably damaging Het
Olfm3 A T 3: 115,122,769 D450V probably damaging Het
Olfr290 T A 7: 84,916,709 I310K probably benign Het
Olfr364-ps1 T A 2: 37,146,872 V220D possibly damaging Het
Olfr731 A G 14: 50,238,124 C254R probably damaging Het
Ormdl1 G A 1: 53,305,522 R81K possibly damaging Het
Pcdhb12 G A 18: 37,435,821 V7I possibly damaging Het
Ptprt A G 2: 162,278,226 I107T probably damaging Het
Rbm27 A C 18: 42,301,774 D301A probably damaging Het
Rexo2 A T 9: 48,468,932 I200N probably damaging Het
Rtn4ip1 A T 10: 43,910,871 I192L probably benign Het
Serpinb9e T C 13: 33,255,119 F176S possibly damaging Het
Sorcs3 C A 19: 48,206,736 A186E possibly damaging Het
Spata31 A G 13: 64,922,024 Y662C probably benign Het
Sphkap G A 1: 83,278,898 P377S possibly damaging Het
Srrt T C 5: 137,300,336 K222R probably benign Het
Tas2r129 T C 6: 132,952,036 I312T probably benign Het
Thbs4 G T 13: 92,776,905 P169Q probably benign Het
Tmtc3 T C 10: 100,451,390 M515V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Other mutations in Mtus2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Mtus2 APN 5 148077009 unclassified probably null
IGL01911:Mtus2 APN 5 148078220 missense probably benign 0.00
IGL01973:Mtus2 APN 5 148303476 splice site probably benign
IGL02452:Mtus2 APN 5 148077663 missense probably benign 0.01
IGL02476:Mtus2 APN 5 148077938 missense probably benign 0.01
IGL02716:Mtus2 APN 5 148236310 missense probably benign 0.05
IGL03194:Mtus2 APN 5 148107103 missense probably damaging 1.00
rumblado UTSW 5 148306708 nonsense probably null
IGL02991:Mtus2 UTSW 5 148313500 missense probably damaging 1.00
PIT4431001:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0101:Mtus2 UTSW 5 148083035 missense probably damaging 1.00
R0310:Mtus2 UTSW 5 148107019 missense probably benign 0.17
R0729:Mtus2 UTSW 5 148077287 missense probably benign 0.08
R0968:Mtus2 UTSW 5 148078184 missense probably benign 0.09
R1231:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1556:Mtus2 UTSW 5 148077388 missense probably benign 0.01
R1561:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1574:Mtus2 UTSW 5 148076552 missense probably benign 0.07
R1750:Mtus2 UTSW 5 148277633 missense probably damaging 0.97
R2318:Mtus2 UTSW 5 148107082 nonsense probably null
R2327:Mtus2 UTSW 5 148077915 missense probably benign 0.00
R3153:Mtus2 UTSW 5 148083060 missense probably damaging 1.00
R3154:Mtus2 UTSW 5 148303273 intron probably benign
R3158:Mtus2 UTSW 5 148231827 missense probably damaging 1.00
R3548:Mtus2 UTSW 5 148295506 missense probably damaging 1.00
R3861:Mtus2 UTSW 5 148313413 missense probably damaging 1.00
R4395:Mtus2 UTSW 5 148076622 missense probably benign 0.17
R4396:Mtus2 UTSW 5 148203938 missense possibly damaging 0.81
R4667:Mtus2 UTSW 5 148298260 missense possibly damaging 0.64
R4887:Mtus2 UTSW 5 148077103 nonsense probably null
R4931:Mtus2 UTSW 5 148077416 missense probably benign 0.09
R5097:Mtus2 UTSW 5 148295582 missense probably damaging 0.99
R5318:Mtus2 UTSW 5 148076572 missense probably benign 0.05
R5372:Mtus2 UTSW 5 148313412 missense probably damaging 1.00
R5388:Mtus2 UTSW 5 148306708 nonsense probably null
R5622:Mtus2 UTSW 5 148078434 missense probably benign 0.09
R6009:Mtus2 UTSW 5 148306652 missense probably damaging 1.00
R6379:Mtus2 UTSW 5 148077198 missense probably benign 0.00
R6409:Mtus2 UTSW 5 148077615 missense probably benign
R6527:Mtus2 UTSW 5 148277598 critical splice acceptor site probably null
R6853:Mtus2 UTSW 5 148107011 missense probably damaging 1.00
R7001:Mtus2 UTSW 5 148277628 missense probably damaging 1.00
R7187:Mtus2 UTSW 5 148076705 missense probably benign 0.01
R7276:Mtus2 UTSW 5 148076558 missense probably benign
R7594:Mtus2 UTSW 5 148077406 missense probably benign 0.44
X0017:Mtus2 UTSW 5 148277600 missense possibly damaging 0.83
X0028:Mtus2 UTSW 5 148077318 missense probably benign 0.03
Z1088:Mtus2 UTSW 5 148303263 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACATTGCGGAAGCACGGCAATC -3'
(R):5'- TCGTCTTAGTGGTGGAAGGACACAG -3'

Sequencing Primer
(F):5'- ACGGCAATCACACTGGG -3'
(R):5'- GGACTCCTTTCAGAAGTCCTG -3'
Posted On2014-01-29