Mutagenetix > Incidental Mutations

Incidental Mutation 'R4396:Usp32'

325497

Institutional Source

Beutler Lab

Gene Symbol

Usp32

Ensembl Gene

ENSMUSG00000000804

Gene Name

ubiquitin specific peptidase 32

Synonyms

6430526O11Rik, 2900074J03Rik

MMRRC Submission

041129-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4396 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84984442-85140161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 85053975 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 296 (L296F)

Ref Sequence

ENSEMBL: ENSMUSP00000103710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108075]

Predicted Effect

probably benign
Transcript: ENSMUST00000108075
AA Change: L296F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: L296F

Domain	Start	End	E-Value	Type
EFh	232	260	4.66e0	SMART
EFh	268	296	5.8e-1	SMART
Blast:EFh	318	346	5e-7	BLAST
DUSP	389	588	2.32e-16	SMART
Pfam:Ubiquitin_3	628	711	2.4e-9	PFAM
Pfam:UCH	733	1564	2.4e-83	PFAM
Pfam:UCH_1	1202	1547	2.9e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172950

Meta Mutation Damage Score

0.1215

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (52/53)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm2	T	C	7: 119,595,920	F552L	probably damaging	Het
Actn2	A	G	13: 12,310,879	L70P	probably damaging	Het
Btbd7	A	G	12: 102,785,293	S1071P	probably benign	Het
Cd200r1	T	A	16: 44,766,054	W16R	probably benign	Het
Cdhr2	A	G	13: 54,715,665	N120D	probably damaging	Het
Col19a1	T	C	1: 24,510,866	T317A	unknown	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dmbt1	T	C	7: 131,116,632	L1683P	probably damaging	Het
Dynll1	A	T	5: 115,300,641	C2S	probably benign	Het
Elp2	T	A	18: 24,609,650	S80T	probably damaging	Het
Fat1	T	A	8: 44,952,346	N711K	probably damaging	Het
Fzd3	A	G	14: 65,235,605	I238T	probably damaging	Het
Galnt7	A	T	8: 57,538,181	F432I	probably damaging	Het
Gemin5	T	A	11: 58,139,549	T817S	probably benign	Het
Gm5414	T	G	15: 101,625,666	E294A	probably damaging	Het
Gm8909	C	A	17: 36,161,969		probably benign	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Kcnj4	C	A	15: 79,484,673	A369S	probably benign	Het
Llgl1	T	C	11: 60,706,008	V145A	probably benign	Het
Mdga1	T	C	17: 29,850,517	D185G	probably damaging	Het
Mettl2	A	G	11: 105,126,778	D38G	probably damaging	Het
Mfsd13a	C	T	19: 46,371,992	R328C	probably damaging	Het
Mpp4	T	C	1: 59,144,802	I260V	possibly damaging	Het
Mtcl1	T	C	17: 66,344,225	E1112G	probably damaging	Het
Mtus2	T	A	5: 148,203,938	N871K	possibly damaging	Het
Mylk	C	T	16: 34,912,275	Q642*	probably null	Het
Naip6	C	T	13: 100,300,600	A472T	probably benign	Het
Olfr1308	A	G	2: 111,960,215	I286T	probably damaging	Het
Pdzd2	A	T	15: 12,387,646	D875E	probably benign	Het
Piezo1	G	T	8: 122,498,674	T557K	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Plxnb1	T	C	9: 109,100,223	V49A	possibly damaging	Het
Pramel6	A	T	2: 87,508,530	I25F	probably damaging	Het
Rreb1	C	T	13: 37,930,443	Q593*	probably null	Het
Scn8a	A	G	15: 100,972,830	N254S	probably damaging	Het
Scnn1g	T	G	7: 121,740,427	S150A	probably benign	Het
Sec24a	A	G	11: 51,715,164	F686L	possibly damaging	Het
Sirt1	T	C	10: 63,321,998	T546A	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Traf5	A	T	1: 191,997,845	V415E	probably benign	Het
Traip	C	G	9: 107,959,487	T110S	probably benign	Het
Treml2	T	C	17: 48,308,114	V209A	probably benign	Het
Trpv5	T	C	6: 41,657,896	S500G	probably benign	Het
Vmn2r79	A	G	7: 87,001,891	H166R	possibly damaging	Het
Zswim1	A	G	2: 164,825,449	D207G	probably damaging	Het

Other mutations in Usp32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00529:Usp32	APN	11	84994426	missense	probably damaging	1.00
IGL00701:Usp32	APN	11	85059125	splice site	probably null
IGL00848:Usp32	APN	11	85051181	splice site	probably benign
IGL00934:Usp32	APN	11	85007076	missense	probably damaging	1.00
IGL01019:Usp32	APN	11	85039265	missense	probably damaging	0.97
IGL01302:Usp32	APN	11	84988482	missense	probably benign	0.05
IGL01444:Usp32	APN	11	85059164	missense	probably damaging	0.97
IGL01575:Usp32	APN	11	85022802	missense	probably damaging	1.00
IGL01981:Usp32	APN	11	85036524	missense	probably benign	0.02
IGL02118:Usp32	APN	11	85032177	nonsense	probably null
IGL02159:Usp32	APN	11	85005802	splice site	probably null
IGL02227:Usp32	APN	11	84986481	missense	probably damaging	1.00
IGL02363:Usp32	APN	11	85044787	missense	probably benign	0.01
IGL02524:Usp32	APN	11	85010011	nonsense	probably null
IGL02613:Usp32	APN	11	85040070	missense	probably damaging	0.99
IGL02720:Usp32	APN	11	85006991	critical splice donor site	probably null
IGL02738:Usp32	APN	11	85083806	missense	probably damaging	1.00
IGL02929:Usp32	APN	11	84988372	missense	probably benign	0.01
IGL03303:Usp32	APN	11	85022832	missense	probably damaging	1.00
BB010:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
BB020:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
PIT4812001:Usp32	UTSW	11	85010074	missense	probably damaging	1.00
R0026:Usp32	UTSW	11	85032074	missense	possibly damaging	0.48
R0295:Usp32	UTSW	11	85053692	missense	probably damaging	0.98
R1320:Usp32	UTSW	11	85017793	missense	probably damaging	0.98
R1712:Usp32	UTSW	11	85042580	missense	probably benign	0.12
R1922:Usp32	UTSW	11	85007004	nonsense	probably null
R1973:Usp32	UTSW	11	85103931	missense	probably benign	0.09
R2010:Usp32	UTSW	11	85040004	missense	probably damaging	0.98
R2082:Usp32	UTSW	11	85030512	missense	probably damaging	0.99
R2355:Usp32	UTSW	11	85005909	missense	probably benign	0.34
R3147:Usp32	UTSW	11	85029087	missense	probably damaging	1.00
R3160:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3162:Usp32	UTSW	11	85025536	missense	probably damaging	0.97
R3716:Usp32	UTSW	11	85042563	missense	probably damaging	1.00
R3816:Usp32	UTSW	11	84994384	critical splice donor site	probably null
R3870:Usp32	UTSW	11	85007055	nonsense	probably null
R3871:Usp32	UTSW	11	85081156	missense	probably null	0.81
R4041:Usp32	UTSW	11	85017739	missense	probably benign	0.40
R4079:Usp32	UTSW	11	85039229	missense	probably damaging	0.98
R4332:Usp32	UTSW	11	85103978	missense	possibly damaging	0.79
R4580:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4620:Usp32	UTSW	11	85059127	critical splice donor site	probably null
R4744:Usp32	UTSW	11	84994393	missense	probably damaging	1.00
R4909:Usp32	UTSW	11	85055772	nonsense	probably null
R5056:Usp32	UTSW	11	85026795	missense	probably benign	0.07
R5111:Usp32	UTSW	11	85077331	missense	possibly damaging	0.95
R5213:Usp32	UTSW	11	85022259	missense	probably damaging	1.00
R5308:Usp32	UTSW	11	85017718	missense	probably benign	0.12
R5381:Usp32	UTSW	11	85059127	critical splice donor site	probably benign
R5538:Usp32	UTSW	11	85017786	missense	possibly damaging	0.65
R5659:Usp32	UTSW	11	85077414	missense	possibly damaging	0.94
R6006:Usp32	UTSW	11	84992451	critical splice donor site	probably null
R6011:Usp32	UTSW	11	85032097	missense	possibly damaging	0.70
R6029:Usp32	UTSW	11	85025582	missense	probably damaging	0.99
R6074:Usp32	UTSW	11	84994573	missense	probably benign	0.00
R6331:Usp32	UTSW	11	84986576	missense	possibly damaging	0.92
R6353:Usp32	UTSW	11	85022281	missense	probably benign
R6714:Usp32	UTSW	11	85026870	missense	probably damaging	0.99
R6778:Usp32	UTSW	11	85025686	missense	probably benign	0.00
R6988:Usp32	UTSW	11	85010143	missense	probably benign	0.35
R6992:Usp32	UTSW	11	85032088	missense	probably damaging	0.99
R7182:Usp32	UTSW	11	85040170	missense	probably benign	0.34
R7186:Usp32	UTSW	11	85051234	missense	probably benign	0.45
R7198:Usp32	UTSW	11	85022855	frame shift	probably null
R7201:Usp32	UTSW	11	85022855	frame shift	probably null
R7469:Usp32	UTSW	11	84988553	missense	possibly damaging	0.94
R7502:Usp32	UTSW	11	85022898	missense	possibly damaging	0.48
R7513:Usp32	UTSW	11	85027112	nonsense	probably null
R7629:Usp32	UTSW	11	85019855	frame shift	probably null
R7703:Usp32	UTSW	11	85077327	missense	probably damaging	0.99
R7741:Usp32	UTSW	11	84987281	missense	probably damaging	0.99
R7765:Usp32	UTSW	11	84994408	missense	probably damaging	1.00
R7933:Usp32	UTSW	11	85007059	missense	probably damaging	1.00
R7973:Usp32	UTSW	11	85022808	missense	probably damaging	0.99
R7989:Usp32	UTSW	11	85034300	missense
R7998:Usp32	UTSW	11	84994426	missense	probably damaging	1.00
R8292:Usp32	UTSW	11	85077401	missense	probably damaging	0.99
R8305:Usp32	UTSW	11	85032185	missense	possibly damaging	0.83
R8548:Usp32	UTSW	11	85017827	missense	possibly damaging	0.52
X0028:Usp32	UTSW	11	84992606	missense	probably benign	0.05
Z1177:Usp32	UTSW	11	84988612	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGACATTCATTCCATCTACCTAGC -3'
(R):5'- GAGGTCTGTTCACAATTCTACATG -3'

Sequencing Primer
(F):5'- TCAGAACTTCGCAGGACA -3'
(R):5'- CCTTATGGGAACTGCTACAGC -3'

Posted On

2015-07-06