Incidental Mutation 'R0044:Bpifb2'
ID 32860
Institutional Source Beutler Lab
Gene Symbol Bpifb2
Ensembl Gene ENSMUSG00000027481
Gene Name BPI fold containing family B, member 2
Synonyms 2310069A01Rik, Bpil1, 2310034L21Rik
MMRRC Submission 038338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R0044 (G1)
Quality Score 210
Status Validated (trace)
Chromosome 2
Chromosomal Location 153875045-153895270 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 153882679 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028983]
AlphaFold Q8C1E1
Predicted Effect probably benign
Transcript: ENSMUST00000028983
SMART Domains Protein: ENSMUSP00000028983
Gene: ENSMUSG00000027481

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:LBP_BPI_CETP 36 194 2.4e-27 PFAM
BPI2 253 456 2.67e-26 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipid transfer/lipopolysaccharide binding protein (LT/LBP) gene family. It is highly expressed in hypertrophic tonsils. This gene and three other members of the LT/LBP gene family form a cluster on the long arm of chromosome 20. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430571L13Rik A C 9: 107,342,499 R50S probably damaging Het
Actn2 G T 13: 12,275,127 T176N possibly damaging Het
Adamts7 T C 9: 90,171,588 V62A possibly damaging Het
Adcy2 A G 13: 68,727,899 S495P possibly damaging Het
Agbl3 A T 6: 34,799,899 M447L probably damaging Het
Asxl1 C T 2: 153,400,209 T893I probably benign Het
Atp11b T A 3: 35,812,252 I400N probably damaging Het
Capn1 T A 19: 6,014,343 Y42F probably benign Het
Cdk5rap2 A T 4: 70,360,901 L190H probably damaging Het
Cfap54 T C 10: 93,035,433 I594V probably null Het
Cpsf1 A G 15: 76,599,553 V830A probably benign Het
Cyp2c70 T A 19: 40,165,371 N258I possibly damaging Het
Dctn1 T G 6: 83,191,134 Y386D probably damaging Het
Degs2 T C 12: 108,692,154 N189D probably damaging Het
Dido1 C T 2: 180,661,819 A1431T probably damaging Het
Diras1 G T 10: 81,022,138 S93* probably null Het
E130308A19Rik T A 4: 59,690,290 H41Q possibly damaging Het
Ebf2 C T 14: 67,310,968 probably benign Het
Fcho2 A G 13: 98,755,544 probably benign Het
Gbe1 T A 16: 70,561,132 Y681* probably null Het
Gm10036 A C 18: 15,832,816 K8T probably benign Het
Herc1 T A 9: 66,448,175 M2236K probably benign Het
Hmcn2 A T 2: 31,412,508 Y2948F probably damaging Het
Jakmip2 A T 18: 43,582,105 C119S probably benign Het
Kif1b A G 4: 149,263,601 probably benign Het
Kif6 T C 17: 49,832,256 probably benign Het
Lpin1 A T 12: 16,568,529 probably benign Het
Lrp2 T C 2: 69,527,555 I377V probably benign Het
Mavs C A 2: 131,242,024 T147N probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mreg T G 1: 72,162,375 T153P probably damaging Het
Naglu T C 11: 101,071,217 I172T probably damaging Het
Ogdhl T C 14: 32,339,328 V492A possibly damaging Het
Olfr1245 A G 2: 89,575,630 I32T possibly damaging Het
Parvg A G 15: 84,337,882 E323G probably benign Het
Pgap1 A G 1: 54,493,368 L664S probably damaging Het
Pgm2l1 A G 7: 100,250,332 N51S probably benign Het
Pik3r6 A G 11: 68,544,750 T609A probably benign Het
Plcb4 T A 2: 135,971,856 V705E probably damaging Het
Plppr5 T A 3: 117,671,889 probably null Het
Prkg2 C A 5: 98,973,130 D411Y probably damaging Het
Ptprd A G 4: 76,086,329 V63A probably benign Het
Ptprz1 T A 6: 23,007,403 I1655N probably damaging Het
Raf1 T A 6: 115,623,515 D10V probably benign Het
Rexo1 T A 10: 80,544,378 Q928L probably benign Het
Rpl7l1 A C 17: 46,778,530 probably null Het
Rrm2b A G 15: 37,953,688 S39P possibly damaging Het
Scn5a A G 9: 119,492,047 probably null Het
Sgtb A G 13: 104,129,260 T93A probably benign Het
Sigirr G T 7: 141,092,313 probably null Het
Slc16a7 T C 10: 125,228,082 D462G probably benign Het
Slc25a30 C T 14: 75,769,649 A85T probably benign Het
Spata24 A G 18: 35,656,834 S167P probably damaging Het
Spock3 C T 8: 63,144,007 T115I possibly damaging Het
Srgap2 A G 1: 131,319,551 I581T possibly damaging Het
Syn2 A T 6: 115,135,147 M23L unknown Het
Synrg G A 11: 84,009,181 V839I probably damaging Het
Tmtc1 A G 6: 148,412,829 probably benign Het
Tnfaip3 C A 10: 19,011,626 M50I probably damaging Het
Topbp1 T A 9: 103,325,773 I721N possibly damaging Het
Ttc22 T G 4: 106,636,806 V321G probably benign Het
Ttc25 A T 11: 100,567,001 I477F probably damaging Het
Ubr2 A G 17: 46,992,985 probably benign Het
Ubr4 T C 4: 139,437,058 probably benign Het
Usp24 T C 4: 106,412,084 probably benign Het
Vmn2r100 A T 17: 19,522,179 I272L possibly damaging Het
Vrtn T A 12: 84,648,605 L43H probably damaging Het
Wnk1 G T 6: 120,037,149 R162S probably damaging Het
Xkr9 G A 1: 13,684,062 W93* probably null Het
Zfp804b G T 5: 6,769,655 P1136H probably damaging Het
Other mutations in Bpifb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:Bpifb2 APN 2 153891275 splice site probably benign
IGL02164:Bpifb2 APN 2 153883562 missense probably damaging 0.99
IGL03063:Bpifb2 APN 2 153889124 missense probably damaging 1.00
R0044:Bpifb2 UTSW 2 153882679 splice site probably benign
R0084:Bpifb2 UTSW 2 153891091 missense probably benign 0.03
R0791:Bpifb2 UTSW 2 153878519 missense probably benign 0.05
R1503:Bpifb2 UTSW 2 153889510 missense possibly damaging 0.83
R2278:Bpifb2 UTSW 2 153878479 nonsense probably null
R3810:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R3812:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R4030:Bpifb2 UTSW 2 153891317 missense probably benign 0.30
R4573:Bpifb2 UTSW 2 153889492 missense probably damaging 0.99
R4713:Bpifb2 UTSW 2 153881193 missense probably damaging 0.98
R5143:Bpifb2 UTSW 2 153878504 missense probably damaging 1.00
R5523:Bpifb2 UTSW 2 153875985 unclassified probably benign
R5899:Bpifb2 UTSW 2 153891130 missense probably damaging 1.00
R6011:Bpifb2 UTSW 2 153889576 splice site probably null
R6172:Bpifb2 UTSW 2 153890412 missense probably benign 0.15
R6378:Bpifb2 UTSW 2 153891152 missense possibly damaging 0.93
R6878:Bpifb2 UTSW 2 153875912 unclassified probably benign
R7381:Bpifb2 UTSW 2 153892348 missense probably benign 0.01
R7390:Bpifb2 UTSW 2 153889806 missense possibly damaging 0.89
R7424:Bpifb2 UTSW 2 153890540 missense possibly damaging 0.93
R7473:Bpifb2 UTSW 2 153881196 missense possibly damaging 0.80
R7493:Bpifb2 UTSW 2 153889477 missense possibly damaging 0.74
R8145:Bpifb2 UTSW 2 153891312 missense probably damaging 1.00
R8178:Bpifb2 UTSW 2 153891956 missense probably damaging 0.99
R8725:Bpifb2 UTSW 2 153889436 missense possibly damaging 0.47
R8960:Bpifb2 UTSW 2 153889126 missense possibly damaging 0.90
R9201:Bpifb2 UTSW 2 153891983 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATCTCTGGACTGCTGACTGAGGAC -3'
(R):5'- CATGCATTGGAGCACATACACACAG -3'

Sequencing Primer
(F):5'- CTGAGGACAGAGACTTCTGC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On 2013-05-09