Incidental Mutation 'R4468:Skp1a'
ID329283
Institutional Source Beutler Lab
Gene Symbol Skp1a
Ensembl Gene ENSMUSG00000036309
Gene NameS-phase kinase-associated protein 1A
Synonyms2610043E24Rik, Tceb1l, p19Skp1, 2610206H23Rik
MMRRC Submission 041725-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R4468 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location52231995-52246858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52245078 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 138 (T138I)
Ref Sequence ENSEMBL: ENSMUSP00000104700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037324] [ENSMUST00000109072] [ENSMUST00000116595] [ENSMUST00000147684] [ENSMUST00000166537]
Predicted Effect probably benign
Transcript: ENSMUST00000037324
AA Change: T138I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038744
Gene: ENSMUSG00000036309
AA Change: T138I

DomainStartEndE-ValueType
Skp1 1 112 1.13e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109072
AA Change: T138I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104700
Gene: ENSMUSG00000036309
AA Change: T138I

DomainStartEndE-ValueType
Skp1 1 112 1.13e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116595
SMART Domains Protein: ENSMUSP00000112294
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Pfam:Skp1_POZ 1 28 6.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147684
SMART Domains Protein: ENSMUSP00000129711
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Pfam:Skp1_POZ 2 47 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166537
AA Change: T90I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131833
Gene: ENSMUSG00000036309
AA Change: T90I

DomainStartEndE-ValueType
Skp1 1 64 1.04e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Meta Mutation Damage Score 0.1254 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of SCF complexes, which are composed of this protein, cullin 1, a ring-box protein, and one member of the F-box family of proteins. This protein binds directly to the F-box motif found in F-box proteins. SCF complexes are involved in the regulated ubiquitination of specific protein substrates, which targets them for degradation by the proteosome. Specific F-box proteins recognize different target protein(s), and many specific SCF substrates have been identified including regulators of cell cycle progression and development. Studies have also characterized the protein as an RNA polymerase II elongation factor. Alternative splicing of this gene results in two transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat A T 11: 116,596,955 D160V possibly damaging Het
Abca2 A G 2: 25,444,902 Y1962C probably damaging Het
Adgrv1 T A 13: 81,374,256 M5921L probably benign Het
Bmp2 T C 2: 133,554,454 V10A probably benign Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccdc33 G T 9: 58,069,872 T282K possibly damaging Het
Chd1 T C 17: 15,760,395 I1308T probably damaging Het
Clec4f A G 6: 83,652,433 I381T probably damaging Het
Fam213b T G 4: 154,897,050 K190T probably benign Het
Ifit1bl2 G A 19: 34,619,068 Q383* probably null Het
Igkv6-15 A G 6: 70,406,973 V7A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lancl2 T A 6: 57,713,034 L75H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Mum1 C T 10: 80,240,736 probably benign Het
Olfr104-ps A G 17: 37,362,637 I170M possibly damaging Het
Olfr155 G A 4: 43,854,737 V143M probably benign Het
Olfr847 C T 9: 19,375,648 V78I probably benign Het
Pcdha5 T C 18: 36,962,180 S581P probably benign Het
Phf10 T C 17: 14,952,775 probably null Het
Ppp2r3c C T 12: 55,297,883 W100* probably null Het
Rad9a G A 19: 4,200,294 H143Y probably benign Het
Riox2 T A 16: 59,475,994 probably benign Het
Ros1 T A 10: 52,118,356 Y1276F probably damaging Het
Rps12-ps24 A G 8: 36,026,114 noncoding transcript Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Scn11a G A 9: 119,754,987 L1521F probably damaging Het
Shoc2 A G 19: 54,026,414 Y346C probably damaging Het
Snx29 T A 16: 11,420,701 probably null Het
Sos1 A G 17: 80,453,811 I152T probably damaging Het
Spag17 A T 3: 100,085,366 D1726V probably damaging Het
Tns4 A T 11: 99,070,415 C646S probably benign Het
Txndc11 T C 16: 11,075,223 H881R probably benign Het
Wls C A 3: 159,872,927 A42E probably damaging Het
Other mutations in Skp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0689:Skp1a UTSW 11 52243765 intron probably benign
R1004:Skp1a UTSW 11 52237380 intron probably benign
R1710:Skp1a UTSW 11 52242615 missense probably benign 0.00
R2250:Skp1a UTSW 11 52243619 missense possibly damaging 0.95
R4469:Skp1a UTSW 11 52245078 missense probably benign 0.04
R4592:Skp1a UTSW 11 52243619 missense possibly damaging 0.95
R4976:Skp1a UTSW 11 52243631 missense probably benign 0.01
R5576:Skp1a UTSW 11 52242588 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGGGCAGAGAATTTCATAAGAGTTC -3'
(R):5'- ATCCAGAGACAGATGCACATTATG -3'

Sequencing Primer
(F):5'- AAACGGGGTATCATTTTAAGCTC -3'
(R):5'- AAGACAGGTTTCTCTATGTAGCCCTG -3'
Posted On2015-07-21