Incidental Mutation 'R4497:Zfp81'
ID331045
Institutional Source Beutler Lab
Gene Symbol Zfp81
Ensembl Gene ENSMUSG00000003929
Gene Namezinc finger protein 81
SynonymsKRAB13, Zfp78, Hszfp36, C330034P10Rik, D330034E10Rik
MMRRC Submission 041750-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R4497 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33329342-33358878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33334703 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 379 (I379N)
Ref Sequence ENSEMBL: ENSMUSP00000050728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054072]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054072
AA Change: I379N

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050728
Gene: ENSMUSG00000003929
AA Change: I379N

DomainStartEndE-ValueType
KRAB 4 55 1.15e-14 SMART
ZnF_C2H2 222 244 1.04e-3 SMART
ZnF_C2H2 250 272 1.53e-1 SMART
ZnF_C2H2 278 300 1.33e-1 SMART
ZnF_C2H2 306 328 5.21e-4 SMART
ZnF_C2H2 334 356 2.2e-2 SMART
ZnF_C2H2 362 384 1.58e-3 SMART
ZnF_C2H2 390 412 1.64e-1 SMART
ZnF_C2H2 418 440 7.67e-2 SMART
ZnF_C2H2 446 468 1.89e-1 SMART
ZnF_C2H2 474 496 2.86e-1 SMART
ZnF_C2H2 502 524 1.08e-1 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 G A 15: 81,895,285 A97T probably damaging Het
Adat1 T C 8: 111,979,362 S371G probably benign Het
Aoc3 T G 11: 101,332,045 I369R possibly damaging Het
Apobr A T 7: 126,587,522 probably null Het
Arhgap12 A T 18: 6,111,774 C69S probably damaging Het
Astn2 A G 4: 66,119,063 probably benign Het
Bcas1 T C 2: 170,406,821 D60G probably damaging Het
Cacnb4 T A 2: 52,477,771 D62V probably damaging Het
Cbx8 C A 11: 119,040,792 R20L probably damaging Het
Ccdc92 G A 5: 124,836,273 T64M probably benign Het
Cps1 G T 1: 67,205,199 S1135I probably null Het
Eml2 G A 7: 19,179,350 R91H probably damaging Het
Fbxl3 G A 14: 103,082,877 P426L probably damaging Het
Fhod3 T A 18: 25,110,239 probably null Het
Gabrb2 T C 11: 42,597,694 I329T probably benign Het
Gli3 T A 13: 15,723,571 D745E possibly damaging Het
Lacc1 T A 14: 77,034,030 N239I probably damaging Het
Lamb2 T A 9: 108,486,798 C1008S probably damaging Het
Man2b1 G A 8: 85,090,936 V349I probably benign Het
Mib1 A G 18: 10,811,985 T961A possibly damaging Het
Mmp24 A G 2: 155,813,988 I449V possibly damaging Het
Myo7b A G 18: 32,014,229 I87T probably benign Het
Olfr156 A G 4: 43,821,175 F62S probably damaging Het
Olfr497 T A 7: 108,422,915 C115S probably benign Het
Pgr A G 9: 8,958,419 E809G probably damaging Het
Ppp1r3g T A 13: 35,969,620 V341E probably benign Het
Prkdc T A 16: 15,700,653 S1091T probably benign Het
Rab44 G A 17: 29,139,897 R353K probably benign Het
Reck G A 4: 43,891,001 M46I probably benign Het
Rorb G T 19: 18,977,628 S208Y possibly damaging Het
Serinc2 G T 4: 130,254,054 T410N possibly damaging Het
Slc23a2 G A 2: 132,056,782 R612* probably null Het
Slx4 T C 16: 3,994,909 E145G probably damaging Het
Spag16 A G 1: 70,493,830 D556G probably damaging Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssfa2 T A 2: 79,657,820 V749E probably damaging Het
Tmf1 A T 6: 97,172,332 F485I probably benign Het
Trmo C T 4: 46,382,140 V326M probably damaging Het
Tssk5 T C 15: 76,372,211 D336G probably damaging Het
Ttyh2 A T 11: 114,710,963 Q471L possibly damaging Het
Wdr33 A C 18: 31,893,079 Q944H unknown Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Zbtb18 A T 1: 177,447,121 S7C probably damaging Het
Zfhx4 G A 3: 5,399,620 V1638M possibly damaging Het
Other mutations in Zfp81
AlleleSourceChrCoordTypePredicted EffectPPH Score
feuer UTSW 17 33334333 nonsense probably null
R0143:Zfp81 UTSW 17 33335121 missense possibly damaging 0.85
R0220:Zfp81 UTSW 17 33336724 missense possibly damaging 0.93
R0520:Zfp81 UTSW 17 33334377 missense probably damaging 0.97
R0611:Zfp81 UTSW 17 33334619 missense probably benign 0.02
R1171:Zfp81 UTSW 17 33335280 missense probably benign
R1613:Zfp81 UTSW 17 33334783 missense probably damaging 0.98
R1779:Zfp81 UTSW 17 33335106 missense probably benign 0.06
R1970:Zfp81 UTSW 17 33335501 missense probably benign
R2063:Zfp81 UTSW 17 33335304 missense probably benign 0.03
R2314:Zfp81 UTSW 17 33334623 missense probably damaging 0.99
R2898:Zfp81 UTSW 17 33334300 nonsense probably null
R3115:Zfp81 UTSW 17 33334563 missense possibly damaging 0.80
R4207:Zfp81 UTSW 17 33334916 missense probably damaging 1.00
R4498:Zfp81 UTSW 17 33334703 missense possibly damaging 0.47
R5756:Zfp81 UTSW 17 33334333 nonsense probably null
R5964:Zfp81 UTSW 17 33336845 missense probably damaging 0.99
R6671:Zfp81 UTSW 17 33335439 missense probably benign 0.17
R7728:Zfp81 UTSW 17 33336817 missense possibly damaging 0.95
Z1176:Zfp81 UTSW 17 33334829 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACATTGGTATAAGTTCTACCCACTAG -3'
(R):5'- ATGTAGTTATGGTCAGTCATATGAAAG -3'

Sequencing Primer
(F):5'- GTGAATGCATGCCCACATTG -3'
(R):5'- GGAAAGCTTTCATTCATCCAAGGGC -3'
Posted On2015-07-21