Incidental Mutation 'R4499:Slc47a1'
ID331759
Institutional Source Beutler Lab
Gene Symbol Slc47a1
Ensembl Gene ENSMUSG00000010122
Gene Namesolute carrier family 47, member 1
SynonymsmMATE1, 1300013J15Rik, MATE1
MMRRC Submission 041752-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4499 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61343401-61378345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61359529 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 341 (I341L)
Ref Sequence ENSEMBL: ENSMUSP00000010267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010267] [ENSMUST00000010267] [ENSMUST00000131723] [ENSMUST00000148671]
Predicted Effect probably benign
Transcript: ENSMUST00000010267
AA Change: I341L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010267
Gene: ENSMUSG00000010122
AA Change: I341L

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 204 4.8e-34 PFAM
low complexity region 225 236 N/A INTRINSIC
Pfam:MatE 265 426 1.6e-32 PFAM
low complexity region 442 452 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000010267
AA Change: I341L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010267
Gene: ENSMUSG00000010122
AA Change: I341L

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 204 4.8e-34 PFAM
low complexity region 225 236 N/A INTRINSIC
Pfam:MatE 265 426 1.6e-32 PFAM
low complexity region 442 452 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131723
SMART Domains Protein: ENSMUSP00000115132
Gene: ENSMUSG00000010122

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:MatE 44 180 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147583
Predicted Effect probably benign
Transcript: ENSMUST00000148671
SMART Domains Protein: ENSMUSP00000118265
Gene: ENSMUSG00000010122

DomainStartEndE-ValueType
Pfam:MatE 1 154 4.5e-30 PFAM
transmembrane domain 164 186 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. It encodes a protein of unknown function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased blood urea nitrogen, increased circulating creatinine, and abnormal metformin pahrmacokinetics including increased plasma and tissue concentration with decreased kidney and liver clearance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,527 W948R possibly damaging Het
Ache A C 5: 137,291,932 M508L probably damaging Het
Adgrb2 A T 4: 129,992,661 E198V probably damaging Het
Adgrl4 A G 3: 151,510,785 N535S possibly damaging Het
Agbl3 T C 6: 34,857,598 S906P probably benign Het
Akna T C 4: 63,395,041 T282A probably benign Het
Arfgef2 G A 2: 166,885,814 V1561M probably damaging Het
Arfgef3 T C 10: 18,608,343 D1388G possibly damaging Het
Asnsd1 A G 1: 53,347,970 V166A probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bpifb5 A T 2: 154,240,758 I484F possibly damaging Het
Camta2 T C 11: 70,674,686 E788G probably damaging Het
Ccdc18 T G 5: 108,228,960 S1422R possibly damaging Het
Cdc42bpg C T 19: 6,320,555 P1226L possibly damaging Het
Cep126 T C 9: 8,101,588 N315S possibly damaging Het
Dcaf4 T A 12: 83,539,360 L367Q probably damaging Het
Dcc A T 18: 71,547,317 V616D probably benign Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dgkq C G 5: 108,649,661 E788D possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Gm14124 T G 2: 150,269,442 V684G possibly damaging Het
Gm8221 T A 15: 77,626,045 noncoding transcript Het
Ice1 T C 13: 70,609,027 S280G possibly damaging Het
Lrrc2 A T 9: 110,962,645 Q155L probably benign Het
Mesd G A 7: 83,897,977 R216Q probably benign Het
Msh6 T A 17: 87,980,269 N112K probably damaging Het
Myo15b A G 11: 115,890,952 E307G probably benign Het
Nod1 T A 6: 54,943,996 N446Y probably damaging Het
Nrap G A 19: 56,351,481 T787I probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Psg25 C T 7: 18,524,891 E287K possibly damaging Het
Rusc1 T C 3: 89,092,308 S56G probably benign Het
Slc16a7 T C 10: 125,228,187 N427S probably damaging Het
Slc9a8 T A 2: 167,424,193 L30Q probably benign Het
Ssh2 T A 11: 77,393,067 L49* probably null Het
Stard9 T A 2: 120,700,241 D2326E probably benign Het
Thbs1 T C 2: 118,119,950 I688T possibly damaging Het
Ttn T A 2: 76,916,478 E4742D probably benign Het
Vps37b T C 5: 124,007,626 I117V probably damaging Het
Xirp2 A T 2: 67,513,438 M2008L probably benign Het
Zfp53 A G 17: 21,509,235 E510G probably damaging Het
Zswim8 T A 14: 20,714,297 S578R probably benign Het
Other mutations in Slc47a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02333:Slc47a1 APN 11 61370124 missense probably damaging 1.00
IGL02399:Slc47a1 APN 11 61363058 missense probably damaging 1.00
IGL02586:Slc47a1 APN 11 61344321 missense probably benign 0.14
IGL02832:Slc47a1 APN 11 61363413 missense probably benign 0.01
IGL02873:Slc47a1 APN 11 61362817 unclassified probably benign
IGL03038:Slc47a1 APN 11 61353092 missense probably benign 0.14
R0392:Slc47a1 UTSW 11 61371782 missense probably damaging 1.00
R0927:Slc47a1 UTSW 11 61373422 missense probably damaging 0.96
R1255:Slc47a1 UTSW 11 61370148 missense probably damaging 1.00
R1507:Slc47a1 UTSW 11 61359518 critical splice donor site probably null
R1625:Slc47a1 UTSW 11 61371799 missense probably damaging 1.00
R2029:Slc47a1 UTSW 11 61378007 intron probably benign
R2137:Slc47a1 UTSW 11 61344492 missense probably benign 0.21
R2434:Slc47a1 UTSW 11 61367722 splice site probably null
R3115:Slc47a1 UTSW 11 61367680 missense possibly damaging 0.88
R3752:Slc47a1 UTSW 11 61344381 missense possibly damaging 0.84
R3839:Slc47a1 UTSW 11 61353058 splice site probably benign
R4516:Slc47a1 UTSW 11 61344513 missense probably benign
R4675:Slc47a1 UTSW 11 61363031 missense probably benign 0.41
R4727:Slc47a1 UTSW 11 61363451 missense possibly damaging 0.48
R4839:Slc47a1 UTSW 11 61373350 splice site probably null
R4869:Slc47a1 UTSW 11 61362694 missense probably benign 0.02
R5164:Slc47a1 UTSW 11 61353060 splice site probably null
R5633:Slc47a1 UTSW 11 61369261 missense probably damaging 1.00
R5957:Slc47a1 UTSW 11 61344342 missense probably benign 0.06
R6793:Slc47a1 UTSW 11 61359403 missense probably benign
R6952:Slc47a1 UTSW 11 61344454 missense probably benign 0.04
R7082:Slc47a1 UTSW 11 61377941 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATCCCACGTGTCAAGAGAATCC -3'
(R):5'- GAAACCATGTTTTGCCAGTGAG -3'

Sequencing Primer
(F):5'- GTGTCAAGAGAATCCCAGCACTC -3'
(R):5'- TTGCCAGTGAGGTGTAAATCAC -3'
Posted On2015-07-21