Incidental Mutation 'R4499:Ssh2'
ID331761
Institutional Source Beutler Lab
Gene Symbol Ssh2
Ensembl Gene ENSMUSG00000037926
Gene Nameslingshot protein phosphatase 2
SynonymsSSH-2
MMRRC Submission 041752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R4499 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77216287-77460220 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 77393067 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 49 (L49*)
Ref Sequence ENSEMBL: ENSMUSP00000137933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000156488] [ENSMUST00000181283]
Predicted Effect probably null
Transcript: ENSMUST00000037912
AA Change: L42*
SMART Domains Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: L42*

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:DEK_C 251 302 3.1e-13 PFAM
DSPc 307 445 2.2e-41 SMART
low complexity region 459 469 N/A INTRINSIC
low complexity region 871 882 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127890
Predicted Effect probably null
Transcript: ENSMUST00000156488
AA Change: L69*
SMART Domains Protein: ENSMUSP00000119681
Gene: ENSMUSG00000037926
AA Change: L69*

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180554
Predicted Effect probably null
Transcript: ENSMUST00000181283
AA Change: L49*
SMART Domains Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: L49*

DomainStartEndE-ValueType
Pfam:DEK_C 256 309 1.7e-18 PFAM
DSPc 313 451 2.2e-41 SMART
low complexity region 465 475 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1376 1391 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,527 W948R possibly damaging Het
Ache A C 5: 137,291,932 M508L probably damaging Het
Adgrb2 A T 4: 129,992,661 E198V probably damaging Het
Adgrl4 A G 3: 151,510,785 N535S possibly damaging Het
Agbl3 T C 6: 34,857,598 S906P probably benign Het
Akna T C 4: 63,395,041 T282A probably benign Het
Arfgef2 G A 2: 166,885,814 V1561M probably damaging Het
Arfgef3 T C 10: 18,608,343 D1388G possibly damaging Het
Asnsd1 A G 1: 53,347,970 V166A probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bpifb5 A T 2: 154,240,758 I484F possibly damaging Het
Camta2 T C 11: 70,674,686 E788G probably damaging Het
Ccdc18 T G 5: 108,228,960 S1422R possibly damaging Het
Cdc42bpg C T 19: 6,320,555 P1226L possibly damaging Het
Cep126 T C 9: 8,101,588 N315S possibly damaging Het
Dcaf4 T A 12: 83,539,360 L367Q probably damaging Het
Dcc A T 18: 71,547,317 V616D probably benign Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dgkq C G 5: 108,649,661 E788D possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Gm14124 T G 2: 150,269,442 V684G possibly damaging Het
Gm8221 T A 15: 77,626,045 noncoding transcript Het
Ice1 T C 13: 70,609,027 S280G possibly damaging Het
Lrrc2 A T 9: 110,962,645 Q155L probably benign Het
Mesd G A 7: 83,897,977 R216Q probably benign Het
Msh6 T A 17: 87,980,269 N112K probably damaging Het
Myo15b A G 11: 115,890,952 E307G probably benign Het
Nod1 T A 6: 54,943,996 N446Y probably damaging Het
Nrap G A 19: 56,351,481 T787I probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Psg25 C T 7: 18,524,891 E287K possibly damaging Het
Rusc1 T C 3: 89,092,308 S56G probably benign Het
Slc16a7 T C 10: 125,228,187 N427S probably damaging Het
Slc47a1 T A 11: 61,359,529 I341L probably benign Het
Slc9a8 T A 2: 167,424,193 L30Q probably benign Het
Stard9 T A 2: 120,700,241 D2326E probably benign Het
Thbs1 T C 2: 118,119,950 I688T possibly damaging Het
Ttn T A 2: 76,916,478 E4742D probably benign Het
Vps37b T C 5: 124,007,626 I117V probably damaging Het
Xirp2 A T 2: 67,513,438 M2008L probably benign Het
Zfp53 A G 17: 21,509,235 E510G probably damaging Het
Zswim8 T A 14: 20,714,297 S578R probably benign Het
Other mutations in Ssh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Ssh2 APN 11 77441926 missense probably damaging 1.00
IGL01141:Ssh2 APN 11 77449726 missense probably damaging 1.00
IGL01520:Ssh2 APN 11 77449906 missense probably damaging 1.00
IGL01803:Ssh2 APN 11 77425330 missense probably damaging 0.99
IGL01989:Ssh2 APN 11 77453685 missense possibly damaging 0.79
IGL02322:Ssh2 APN 11 77416413 critical splice acceptor site probably null
IGL02466:Ssh2 APN 11 77416407 splice site probably benign
IGL02683:Ssh2 APN 11 77398256 missense probably damaging 0.99
IGL02706:Ssh2 APN 11 77453406 missense possibly damaging 0.68
IGL02719:Ssh2 APN 11 77425587 missense probably damaging 1.00
IGL02721:Ssh2 APN 11 77454725 nonsense probably null
IGL02732:Ssh2 APN 11 77437776 splice site probably null
IGL02745:Ssh2 APN 11 77455407 missense probably damaging 1.00
IGL02993:Ssh2 APN 11 77453544 missense probably damaging 1.00
IGL03000:Ssh2 APN 11 77421206 splice site probably benign
IGL03055:Ssh2 UTSW 11 77408195 nonsense probably null
R0024:Ssh2 UTSW 11 77454966 missense possibly damaging 0.68
R0374:Ssh2 UTSW 11 77408143 missense probably damaging 1.00
R0539:Ssh2 UTSW 11 77454794 missense probably benign 0.11
R0834:Ssh2 UTSW 11 77437633 missense possibly damaging 0.87
R1714:Ssh2 UTSW 11 77454024 missense possibly damaging 0.94
R1743:Ssh2 UTSW 11 77437756 missense probably damaging 1.00
R1889:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R1895:Ssh2 UTSW 11 77449745 missense probably damaging 1.00
R3945:Ssh2 UTSW 11 77454668 missense possibly damaging 0.93
R3947:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R3948:Ssh2 UTSW 11 77398256 missense probably damaging 0.99
R4133:Ssh2 UTSW 11 77421269 missense probably damaging 1.00
R4256:Ssh2 UTSW 11 77408183 missense possibly damaging 0.48
R4548:Ssh2 UTSW 11 77450184 missense probably benign 0.20
R4644:Ssh2 UTSW 11 77449576 missense possibly damaging 0.46
R4690:Ssh2 UTSW 11 77455205 missense possibly damaging 0.62
R4788:Ssh2 UTSW 11 77429798 missense probably damaging 1.00
R4919:Ssh2 UTSW 11 77425320 missense possibly damaging 0.91
R5014:Ssh2 UTSW 11 77455276 nonsense probably null
R5380:Ssh2 UTSW 11 77453945 missense probably benign 0.01
R5574:Ssh2 UTSW 11 77450115 missense probably benign
R5593:Ssh2 UTSW 11 77421366 missense probably damaging 0.99
R5739:Ssh2 UTSW 11 77449813 missense probably damaging 1.00
R6180:Ssh2 UTSW 11 77453465 missense probably benign 0.43
R6542:Ssh2 UTSW 11 77450150 missense possibly damaging 0.94
R6713:Ssh2 UTSW 11 77449433 missense possibly damaging 0.89
R7108:Ssh2 UTSW 11 77454794 missense probably benign
R7124:Ssh2 UTSW 11 77454338 missense probably benign 0.00
R7255:Ssh2 UTSW 11 77425593 missense probably damaging 1.00
R7332:Ssh2 UTSW 11 77453523 missense possibly damaging 0.48
R7362:Ssh2 UTSW 11 77449650 missense probably benign 0.01
R7395:Ssh2 UTSW 11 77393073 missense probably damaging 0.99
R7412:Ssh2 UTSW 11 77450108 missense probably damaging 0.98
R7493:Ssh2 UTSW 11 77437716 missense probably benign 0.16
R7686:Ssh2 UTSW 11 77425324 missense possibly damaging 0.89
R7870:Ssh2 UTSW 11 77453615 missense probably benign
R7895:Ssh2 UTSW 11 77454626 missense probably benign 0.41
R7953:Ssh2 UTSW 11 77453615 missense probably benign
R7978:Ssh2 UTSW 11 77454626 missense probably benign 0.41
R8030:Ssh2 UTSW 11 77454506 missense probably benign 0.01
R8065:Ssh2 UTSW 11 77441985 missense probably damaging 1.00
RF018:Ssh2 UTSW 11 77454054 missense probably damaging 0.99
X0017:Ssh2 UTSW 11 77441898 missense probably damaging 1.00
Z1088:Ssh2 UTSW 11 77449495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTCTCCTCTTGAATTTGTTAGGA -3'
(R):5'- ACCACCAAATTTAAGGCAAAAGGT -3'

Sequencing Primer
(F):5'- TATATCCCAGAGTAGCCTTGAGC -3'
(R):5'- AAGACTCAGTCCACTTTGGG -3'
Posted On2015-07-21