Incidental Mutation 'R4536:Atpif1'
ID333319
Institutional Source Beutler Lab
Gene Symbol Atpif1
Ensembl Gene ENSMUSG00000054428
Gene NameATPase inhibitory factor 1
SynonymsIf1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4536 (G1)
Quality Score112
Status Not validated
Chromosome4
Chromosomal Location132530555-132533659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 132533559 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 4 (S4A)
Ref Sequence ENSEMBL: ENSMUSP00000064282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067467] [ENSMUST00000067496] [ENSMUST00000094657] [ENSMUST00000105939] [ENSMUST00000105940] [ENSMUST00000138334] [ENSMUST00000139074] [ENSMUST00000144073] [ENSMUST00000152993]
Predicted Effect probably benign
Transcript: ENSMUST00000067467
SMART Domains Protein: ENSMUSP00000068069
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
SCOP:d1repc1 23 79 4e-5 SMART
Blast:DnaJ 56 79 6e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000067496
AA Change: S4A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064282
Gene: ENSMUSG00000054428
AA Change: S4A

DomainStartEndE-ValueType
Pfam:IATP 26 106 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094657
SMART Domains Protein: ENSMUSP00000092242
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 115 2.65e-18 SMART
low complexity region 135 146 N/A INTRINSIC
coiled coil region 164 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105938
Predicted Effect probably benign
Transcript: ENSMUST00000105939
SMART Domains Protein: ENSMUSP00000101559
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 22 81 2.09e-16 SMART
low complexity region 101 112 N/A INTRINSIC
coiled coil region 130 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105940
SMART Domains Protein: ENSMUSP00000101560
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 96 2.15e-1 SMART
low complexity region 116 127 N/A INTRINSIC
coiled coil region 145 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124471
Predicted Effect probably benign
Transcript: ENSMUST00000138334
SMART Domains Protein: ENSMUSP00000130135
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
DnaJ 38 84 4.42e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142281
Predicted Effect probably benign
Transcript: ENSMUST00000144073
SMART Domains Protein: ENSMUSP00000131575
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145795
Predicted Effect probably benign
Transcript: ENSMUST00000150207
SMART Domains Protein: ENSMUSP00000121009
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
DnaJ 32 91 2.65e-18 SMART
low complexity region 111 122 N/A INTRINSIC
low complexity region 178 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152993
SMART Domains Protein: ENSMUSP00000133099
Gene: ENSMUSG00000054428

DomainStartEndE-ValueType
Pfam:IATP 1 61 1.8e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ATPase inhibitor family of proteins. This protein has been shown to negatively regulate the ATP hydrolysis activity of the F1Fo-ATPase. Knockdown of this gene is associated with reduced heme synthesis in differentiating erythroid cells. Misregulation of this gene has been found to lead to increased aerobic glycolysis in mouse cancer cells, while high expression levels of this gene have been correlated with gastric and liver cancer severity in human patients. A pseudogene of this gene has been identified. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amot A G X: 145,480,142 S398P probably benign Het
Arhgef17 G C 7: 100,929,854 S629C probably damaging Het
Atp8b2 G A 3: 89,941,784 A1081V probably benign Het
Atr A G 9: 95,874,418 D867G probably benign Het
C1qtnf3 G A 15: 10,972,027 S206N probably damaging Het
Cep152 A C 2: 125,602,947 probably null Het
Cetn1 T C 18: 9,618,998 E141G probably damaging Het
Erbb4 A T 1: 68,346,622 N269K probably damaging Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Frmd4b T A 6: 97,310,732 Q241L possibly damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
Gls2 G A 10: 128,200,937 V196I probably benign Het
Gm15448 T A 7: 3,822,252 M464L probably benign Het
Gm5426 G A 10: 96,136,702 A34T probably benign Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Klhl1 A C 14: 96,136,583 probably null Het
Mettl4 C A 17: 94,735,505 S301I possibly damaging Het
Mlxip G A 5: 123,450,503 D819N probably damaging Het
Olfr975 A T 9: 39,950,435 L112Q probably damaging Het
Pam T A 1: 97,844,699 K440* probably null Het
Phldb2 T C 16: 45,770,681 M996V probably benign Het
Rad51ap2 A G 12: 11,457,849 S591G possibly damaging Het
Rfx6 A G 10: 51,723,784 N542S probably benign Het
Slc44a4 T A 17: 34,923,839 C254S probably damaging Het
Sptbn2 C T 19: 4,732,602 A522V probably damaging Het
St5 A T 7: 109,531,156 S879R probably damaging Het
Syt10 C T 15: 89,782,622 D509N probably damaging Het
Tango2 A G 16: 18,324,355 probably null Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Trafd1 T C 5: 121,379,683 probably null Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Tysnd1 G A 10: 61,696,053 W161* probably null Het
Uggt2 A T 14: 119,019,558 M1088K probably benign Het
Other mutations in Atpif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
macunaima UTSW 4 132533300 missense probably damaging 1.00
R1609:Atpif1 UTSW 4 132530767 missense probably benign 0.00
R5270:Atpif1 UTSW 4 132533300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAAAGAGAGTCGTGGAC -3'
(R):5'- CTGGGTCATGATGCGTTAGAGC -3'

Sequencing Primer
(F):5'- TCGTGGACGTGAAAAGAAAAGGC -3'
(R):5'- GATGCGTTAGAGCCTTGTTTATTAAC -3'
Posted On2015-08-18