Incidental Mutation 'R4527:Mak16'
ID334486
Institutional Source Beutler Lab
Gene Symbol Mak16
Ensembl Gene ENSMUSG00000031578
Gene NameMAK16 homolog
Synonyms2600016B03Rik, Rbm13
MMRRC Submission 041768-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4527 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location31159463-31168764 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 31166177 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 93 (Q93*)
Ref Sequence ENSEMBL: ENSMUSP00000033983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033983] [ENSMUST00000098842] [ENSMUST00000209986] [ENSMUST00000210129]
Predicted Effect probably null
Transcript: ENSMUST00000033983
AA Change: Q93*
SMART Domains Protein: ENSMUSP00000033983
Gene: ENSMUSG00000031578
AA Change: Q93*

DomainStartEndE-ValueType
Pfam:Ribosomal_L28e 6 119 5e-40 PFAM
Pfam:Mak16 138 235 4.7e-36 PFAM
low complexity region 242 256 N/A INTRINSIC
low complexity region 258 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098842
SMART Domains Protein: ENSMUSP00000096441
Gene: ENSMUSG00000031577

DomainStartEndE-ValueType
Pfam:DUF2454 208 397 7.1e-17 PFAM
low complexity region 426 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209991
Predicted Effect probably benign
Transcript: ENSMUST00000210129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210450
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg2 A G 5: 137,684,536 V15A unknown Het
Asb3 A G 11: 31,058,933 D278G probably benign Het
Atrn T C 2: 130,973,504 I780T probably benign Het
Car2 C T 3: 14,898,005 P200L probably damaging Het
Cars A T 7: 143,565,049 M668K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cer1 A G 4: 82,884,669 F139L possibly damaging Het
Crhr2 T A 6: 55,132,853 probably benign Het
Dnah7c G A 1: 46,532,931 E855K probably benign Het
Espn C T 4: 152,135,649 R339Q probably damaging Het
Flt3 T A 5: 147,356,353 E481V probably benign Het
Gorab T G 1: 163,397,136 K32T possibly damaging Het
Muc4 T C 16: 32,755,843 probably benign Het
Neb A T 2: 52,193,237 I5409N probably benign Het
Olfm4 C T 14: 80,021,224 S304F probably benign Het
Pask A G 1: 93,320,502 F1026L probably benign Het
Rab11a A G 9: 64,725,568 S19P probably benign Het
Rab11fip3 T C 17: 26,036,657 D541G probably damaging Het
Rnf10 T C 5: 115,260,151 S108G probably damaging Het
Rps4l-ps C T 7: 114,927,168 noncoding transcript Het
Shank1 A T 7: 44,354,590 H1902L possibly damaging Het
Slc8a3 T C 12: 81,315,853 Y64C probably damaging Het
Sorbs3 A C 14: 70,207,617 I4S probably damaging Het
St18 A G 1: 6,855,423 N935S probably damaging Het
Taf4b T C 18: 14,821,442 V525A probably damaging Het
Timm10b A G 7: 105,682,806 N828S probably benign Het
Ttyh1 A T 7: 4,119,764 D4V probably damaging Het
Usp34 T A 11: 23,421,257 L53Q possibly damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Vmn2r70 A T 7: 85,559,579 N563K probably damaging Het
Xrcc5 C A 1: 72,312,500 N76K probably damaging Het
Zscan25 T C 5: 145,283,458 V21A probably damaging Het
Other mutations in Mak16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Mak16 APN 8 31166750 missense probably benign
IGL02071:Mak16 APN 8 31160529 missense probably benign 0.00
IGL02457:Mak16 APN 8 31164725 missense possibly damaging 0.83
IGL02486:Mak16 APN 8 31160586 intron probably benign
FR4342:Mak16 UTSW 8 31161749 missense probably benign 0.00
R4807:Mak16 UTSW 8 31166133 missense probably benign 0.25
R7178:Mak16 UTSW 8 31166574 missense probably benign 0.06
R7315:Mak16 UTSW 8 31164738 nonsense probably null
R7366:Mak16 UTSW 8 31166099 missense possibly damaging 0.88
R8311:Mak16 UTSW 8 31168669 missense probably damaging 1.00
Z1088:Mak16 UTSW 8 31166095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTGTGACATGGTCCACAG -3'
(R):5'- AGTGACCATTGGGCAAAAGC -3'

Sequencing Primer
(F):5'- GATTTCTGAGTTCAAGGCCAGCC -3'
(R):5'- CCATTGGGCAAAAGCAAAATTG -3'
Posted On2015-08-18