Incidental Mutation 'R0336:Rnf38'
ID34102
Institutional Source Beutler Lab
Gene Symbol Rnf38
Ensembl Gene ENSMUSG00000035696
Gene Namering finger protein 38
Synonyms2610202O07Rik, Oip1, 1700065B19Rik
MMRRC Submission 038545-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R0336 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location44126210-44233789 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 44152350 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045793] [ENSMUST00000098098] [ENSMUST00000102934] [ENSMUST00000107836] [ENSMUST00000128426] [ENSMUST00000136730] [ENSMUST00000143337] [ENSMUST00000145760]
Predicted Effect probably benign
Transcript: ENSMUST00000045793
SMART Domains Protein: ENSMUSP00000038477
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098098
SMART Domains Protein: ENSMUSP00000095702
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 64 83 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 319 342 N/A INTRINSIC
RING 412 452 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102934
SMART Domains Protein: ENSMUSP00000099998
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107836
SMART Domains Protein: ENSMUSP00000103467
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123844
Predicted Effect probably benign
Transcript: ENSMUST00000128426
SMART Domains Protein: ENSMUSP00000119889
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129621
Predicted Effect probably benign
Transcript: ENSMUST00000136730
SMART Domains Protein: ENSMUSP00000116642
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137194
Predicted Effect probably benign
Transcript: ENSMUST00000143337
SMART Domains Protein: ENSMUSP00000122342
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145760
SMART Domains Protein: ENSMUSP00000121329
Gene: ENSMUSG00000035696

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153384
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.1%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a coiled-coil motif and a RING-H2 motif (C3H2C2) at its carboxy-terminus. The RING motif is a zinc-binding domain found in a large set of proteins playing roles in diverse cellular processes including oncogenesis, development, signal transduction, and apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,298,481 I2743V probably benign Het
Adamts16 A G 13: 70,791,794 probably benign Het
Adgrb1 A G 15: 74,587,149 I427V probably benign Het
Apopt1 T C 12: 111,733,658 probably benign Het
Arhgef1 T A 7: 24,921,957 F510I possibly damaging Het
B3glct A G 5: 149,746,592 D342G probably damaging Het
Bcl2a1c G T 9: 114,330,285 V44F probably damaging Het
Brca1 A G 11: 101,523,993 V1105A probably benign Het
Cep135 A G 5: 76,601,502 H272R probably benign Het
Cog1 A C 11: 113,662,250 H365P probably benign Het
Col12a1 A T 9: 79,702,345 L293Q probably damaging Het
Col18a1 A G 10: 77,058,736 L1493P probably damaging Het
Ctsh A G 9: 90,075,738 Y290C probably damaging Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Defb39 G T 8: 19,052,969 H37N possibly damaging Het
Epha3 A G 16: 63,566,648 I875T probably damaging Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fga T C 3: 83,030,857 S180P probably damaging Het
Fndc1 C T 17: 7,765,107 R1329Q unknown Het
Fyn C A 10: 39,526,901 T223K possibly damaging Het
Galnt6 A T 15: 100,699,206 S360T probably damaging Het
Gm10436 T C 12: 88,178,191 I122V probably benign Het
Grsf1 C A 5: 88,663,153 V336F probably damaging Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hivep3 G A 4: 120,103,847 E1700K probably damaging Het
Ifna6 T C 4: 88,827,941 S176P probably damaging Het
Lilr4b T A 10: 51,481,293 L75Q probably benign Het
Lrig3 C T 10: 125,966,705 T77I probably benign Het
Mpped1 C T 15: 83,836,282 P135L probably damaging Het
Mss51 T A 14: 20,483,186 I406F possibly damaging Het
Mybpc2 T C 7: 44,505,616 N956D probably damaging Het
Olfr1197 T C 2: 88,729,154 I148M possibly damaging Het
Podxl2 G A 6: 88,849,595 T243I probably benign Het
Polr2a C T 11: 69,736,893 R1396Q possibly damaging Het
Pygm C T 19: 6,388,758 R205W probably damaging Het
Rfx3 A G 19: 27,806,262 M428T probably benign Het
Ric1 A T 19: 29,587,793 T647S probably damaging Het
Rictor G A 15: 6,776,753 probably null Het
Slc6a21 T A 7: 45,286,468 I41K probably damaging Het
St8sia4 T A 1: 95,653,558 D153V probably benign Het
Stk33 T C 7: 109,331,474 N226S probably benign Het
Strn3 A G 12: 51,661,608 probably null Het
Tlr6 G T 5: 64,953,946 N539K probably benign Het
Tmem129 G T 5: 33,655,602 P134Q probably damaging Het
Tmem94 A G 11: 115,787,385 I145V probably benign Het
Trap1 A C 16: 4,044,626 V596G probably damaging Het
Tspan2 A G 3: 102,735,027 I11V probably null Het
Ttc23 A T 7: 67,662,483 H46L probably benign Het
Txnip T A 3: 96,559,979 D292E probably benign Het
Vmn1r121 T A 7: 21,098,462 I18F possibly damaging Het
Vmn1r61 G A 7: 5,611,067 H83Y probably benign Het
Vmn1r82 T C 7: 12,305,321 S174P probably benign Het
Vmn2r79 A C 7: 87,002,079 T229P probably benign Het
Vps13b T G 15: 35,455,133 Y729* probably null Het
Wisp2 C A 2: 163,832,322 A214D probably damaging Het
Xdh C T 17: 73,922,463 V332M possibly damaging Het
Xkr5 C A 8: 18,940,636 R205L possibly damaging Het
Zc3h4 T C 7: 16,435,178 S1071P unknown Het
Zc3h6 A G 2: 129,015,412 H617R possibly damaging Het
Zfp597 A G 16: 3,866,379 V171A probably benign Het
Zfp709 T C 8: 71,890,605 F626S probably damaging Het
Zfp944 C A 17: 22,339,028 D413Y probably damaging Het
Zfp979 A C 4: 147,613,135 S372R possibly damaging Het
Other mutations in Rnf38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Rnf38 APN 4 44137645 missense probably benign 0.09
IGL01992:Rnf38 APN 4 44138806 missense probably damaging 1.00
IGL02682:Rnf38 APN 4 44133745 missense probably damaging 1.00
IGL02951:Rnf38 APN 4 44129619 nonsense probably null
IGL03032:Rnf38 APN 4 44152529 missense probably damaging 0.99
IGL03326:Rnf38 APN 4 44149182 missense probably benign 0.27
R0335:Rnf38 UTSW 4 44152507 missense possibly damaging 0.59
R1473:Rnf38 UTSW 4 44131584 missense probably benign 0.00
R1552:Rnf38 UTSW 4 44142468 splice site probably null
R1670:Rnf38 UTSW 4 44138681 missense probably damaging 0.96
R1708:Rnf38 UTSW 4 44143593 missense probably damaging 1.00
R1943:Rnf38 UTSW 4 44138748 missense probably damaging 0.99
R2063:Rnf38 UTSW 4 44149098 missense probably damaging 0.99
R4348:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4352:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4353:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4618:Rnf38 UTSW 4 44142450 missense probably damaging 1.00
R4967:Rnf38 UTSW 4 44152460 missense probably damaging 1.00
R5230:Rnf38 UTSW 4 44149176 missense probably benign 0.17
R6275:Rnf38 UTSW 4 44152408 missense probably benign 0.11
R6855:Rnf38 UTSW 4 44149224 missense probably damaging 1.00
R7200:Rnf38 UTSW 4 44137620 missense probably benign 0.01
R7326:Rnf38 UTSW 4 44158989 intron probably benign
R7351:Rnf38 UTSW 4 44149102 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GAAGGGCAGATGGAGGTCATCTCTAA -3'
(R):5'- GGCAGAGTGAAGATAGTCCAAGTCCTAA -3'

Sequencing Primer
(F):5'- caacagtgagccagggag -3'
(R):5'- GTCCAAGTCCTAAGAGACAGCG -3'
Posted On2013-05-09