Incidental Mutation 'R6275:Rnf38'
ID507567
Institutional Source Beutler Lab
Gene Symbol Rnf38
Ensembl Gene ENSMUSG00000035696
Gene Namering finger protein 38
Synonyms2610202O07Rik, Oip1, 1700065B19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R6275 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location44126210-44233789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44152408 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 52 (H52L)
Ref Sequence ENSEMBL: ENSMUSP00000095702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045793] [ENSMUST00000098098] [ENSMUST00000102934] [ENSMUST00000107836] [ENSMUST00000128426] [ENSMUST00000136730] [ENSMUST00000143337] [ENSMUST00000145760]
Predicted Effect probably benign
Transcript: ENSMUST00000045793
AA Change: H20L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000038477
Gene: ENSMUSG00000035696
AA Change: H20L

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098098
AA Change: H52L

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095702
Gene: ENSMUSG00000035696
AA Change: H52L

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 64 83 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 319 342 N/A INTRINSIC
RING 412 452 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102934
AA Change: H20L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099998
Gene: ENSMUSG00000035696
AA Change: H20L

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107836
AA Change: H20L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103467
Gene: ENSMUSG00000035696
AA Change: H20L

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
RING 380 420 9.09e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123844
Predicted Effect probably benign
Transcript: ENSMUST00000128426
AA Change: H20L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119889
Gene: ENSMUSG00000035696
AA Change: H20L

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129621
Predicted Effect probably benign
Transcript: ENSMUST00000136730
AA Change: H20L

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116642
Gene: ENSMUSG00000035696
AA Change: H20L

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 244 258 N/A INTRINSIC
low complexity region 287 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137194
Predicted Effect probably benign
Transcript: ENSMUST00000143337
AA Change: H20L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122342
Gene: ENSMUSG00000035696
AA Change: H20L

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145760
AA Change: H20L

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121329
Gene: ENSMUSG00000035696
AA Change: H20L

DomainStartEndE-ValueType
low complexity region 32 51 N/A INTRINSIC
low complexity region 192 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153384
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a coiled-coil motif and a RING-H2 motif (C3H2C2) at its carboxy-terminus. The RING motif is a zinc-binding domain found in a large set of proteins playing roles in diverse cellular processes including oncogenesis, development, signal transduction, and apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,285,368 D3936G probably damaging Het
Abca7 T A 10: 79,997,791 L30H probably damaging Het
Abcb6 T C 1: 75,172,551 probably null Het
Acsbg1 T A 9: 54,609,772 M586L probably benign Het
Ano6 A T 15: 95,913,433 Y159F probably damaging Het
C1ql1 A G 11: 102,939,749 I254T probably damaging Het
Ccdc81 T C 7: 89,882,311 D318G possibly damaging Het
Ccr7 C T 11: 99,145,663 M144I probably damaging Het
Cdca3 C T 6: 124,832,664 probably null Het
Ces1h A T 8: 93,372,646 L93I probably benign Het
Cntfr T C 4: 41,663,216 D197G possibly damaging Het
Cyp2d12 C A 15: 82,556,658 P126T probably benign Het
Dnah10 A G 5: 124,785,184 T2225A probably damaging Het
Edrf1 A T 7: 133,667,582 N1147Y possibly damaging Het
Ermap C T 4: 119,178,550 V414M probably damaging Het
Fam13a A G 6: 58,954,257 I446T probably damaging Het
Fgfbp3 T C 19: 36,918,753 H155R possibly damaging Het
Folr1 T A 7: 101,859,535 N61I probably damaging Het
Fsip1 T C 2: 118,205,102 I431V probably benign Het
Gm5039 T C 12: 88,321,225 D86G possibly damaging Het
Gm5493 A T 17: 22,750,070 E74D probably benign Het
Gm6803 T C 12: 88,018,485 N96S probably benign Het
H2-Oa A G 17: 34,094,566 D197G probably benign Het
Hps1 T C 19: 42,769,607 E169G probably null Het
Il17rc A T 6: 113,480,347 M372L probably benign Het
Itga10 A G 3: 96,658,185 S1042G probably benign Het
Jchain A T 5: 88,521,353 V147E probably damaging Het
Laptm4b A G 15: 34,283,327 T211A probably benign Het
Mal2 T C 15: 54,571,639 probably null Het
Mov10l1 T A 15: 89,026,620 I1071N probably damaging Het
Mpp2 T A 11: 102,060,969 Y401F probably damaging Het
Myh15 A G 16: 49,145,247 T1172A probably benign Het
Olfr635 T A 7: 103,979,974 S261T probably damaging Het
Pcnx G T 12: 81,918,607 S516I probably benign Het
Pidd1 C T 7: 141,439,795 A685T probably damaging Het
Psg28 A C 7: 18,430,440 Y116D probably damaging Het
Psmd11 T C 11: 80,438,632 probably benign Het
Rapgefl1 T A 11: 98,851,120 Y637N probably damaging Het
Rbm25 T A 12: 83,644,432 M66K probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGTGGCGGCGG 7: 97,579,923 probably benign Het
Sec62 A G 3: 30,809,836 Q89R probably damaging Het
Serpina6 T A 12: 103,648,720 Q289L probably benign Het
Sf3b2 A C 19: 5,283,650 I640S probably damaging Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Slc26a11 T C 11: 119,359,299 F127L probably benign Het
Stac3 T A 10: 127,507,746 Y252* probably null Het
Stoml3 G A 3: 53,507,506 A240T probably damaging Het
Tanc1 A T 2: 59,843,510 H1653L probably benign Het
Tll1 A T 8: 64,051,367 L665* probably null Het
Tnr A C 1: 159,861,270 Q434P probably damaging Het
Tpgs1 C A 10: 79,675,520 D165E probably benign Het
Tsc2 A G 17: 24,600,420 V1185A probably benign Het
Tulp4 A G 17: 6,198,736 H203R probably damaging Het
Txnl4a T A 18: 80,218,765 M72K possibly damaging Het
Usp42 G A 5: 143,714,972 R1099W probably damaging Het
Zfp292 G A 4: 34,808,883 A1387V possibly damaging Het
Zfp994 A T 17: 22,199,991 L659* probably null Het
Other mutations in Rnf38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Rnf38 APN 4 44137645 missense probably benign 0.09
IGL01992:Rnf38 APN 4 44138806 missense probably damaging 1.00
IGL02682:Rnf38 APN 4 44133745 missense probably damaging 1.00
IGL02951:Rnf38 APN 4 44129619 nonsense probably null
IGL03032:Rnf38 APN 4 44152529 missense probably damaging 0.99
IGL03326:Rnf38 APN 4 44149182 missense probably benign 0.27
R0335:Rnf38 UTSW 4 44152507 missense possibly damaging 0.59
R0336:Rnf38 UTSW 4 44152350 splice site probably benign
R1473:Rnf38 UTSW 4 44131584 missense probably benign 0.00
R1552:Rnf38 UTSW 4 44142468 splice site probably null
R1670:Rnf38 UTSW 4 44138681 missense probably damaging 0.96
R1708:Rnf38 UTSW 4 44143593 missense probably damaging 1.00
R1943:Rnf38 UTSW 4 44138748 missense probably damaging 0.99
R2063:Rnf38 UTSW 4 44149098 missense probably damaging 0.99
R4348:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4352:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4353:Rnf38 UTSW 4 44149100 missense possibly damaging 0.84
R4618:Rnf38 UTSW 4 44142450 missense probably damaging 1.00
R4967:Rnf38 UTSW 4 44152460 missense probably damaging 1.00
R5230:Rnf38 UTSW 4 44149176 missense probably benign 0.17
R6855:Rnf38 UTSW 4 44149224 missense probably damaging 1.00
R7200:Rnf38 UTSW 4 44137620 missense probably benign 0.01
R7326:Rnf38 UTSW 4 44158989 intron probably benign
R7351:Rnf38 UTSW 4 44149102 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GGCCAAGATTCACTTAGTCTCTTTC -3'
(R):5'- CTTACGGGTTTATTCAGTTGATCC -3'

Sequencing Primer
(F):5'- AGGAGCTTAATCAATTCCTTATAACC -3'
(R):5'- CAGTTGATCCTTTTTGTTGCATTGGC -3'
Posted On2018-03-15