Incidental Mutation 'R4562:Tmem117'
ID343166
Institutional Source Beutler Lab
Gene Symbol Tmem117
Ensembl Gene ENSMUSG00000063296
Gene Nametransmembrane protein 117
Synonyms
MMRRC Submission 041787-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R4562 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location94629232-95096098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95094796 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 446 (M446L)
Ref Sequence ENSEMBL: ENSMUSP00000079038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080141] [ENSMUST00000229933]
Predicted Effect probably benign
Transcript: ENSMUST00000080141
AA Change: M446L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079038
Gene: ENSMUSG00000063296
AA Change: M446L

DomainStartEndE-ValueType
Pfam:TMEM117 4 416 1.1e-235 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189291
Predicted Effect probably benign
Transcript: ENSMUST00000229933
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G A 3: 36,066,182 R25K probably benign Het
Acap1 C T 11: 69,885,351 probably benign Het
Aox1 T C 1: 58,059,056 L309P probably damaging Het
Arhgap8 A C 15: 84,741,913 D63A probably damaging Het
Asap2 A G 12: 21,112,093 D17G probably damaging Het
Atp8b1 A T 18: 64,556,891 V590D probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Cad G A 5: 31,058,133 S96N possibly damaging Het
Csmd3 T C 15: 47,899,844 T1303A probably benign Het
Defa24 A G 8: 21,734,507 probably benign Het
Dffb A G 4: 153,965,456 C317R probably damaging Het
Erap1 T C 13: 74,673,659 V711A probably benign Het
Esco1 A G 18: 10,595,074 S71P possibly damaging Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Fam208a A G 14: 27,466,308 T904A possibly damaging Het
Gm10797 A G 10: 67,572,685 noncoding transcript Het
Gm10822 C T 2: 73,899,489 noncoding transcript Het
Gm9268 C T 7: 43,023,562 Q130* probably null Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ift22 A G 5: 136,912,870 E152G probably benign Het
Ighv3-5 T A 12: 114,262,878 T25S possibly damaging Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcna5 T C 6: 126,534,340 H275R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klf14 G A 6: 30,958,459 A80V probably damaging Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Lypd8 T A 11: 58,382,389 probably null Het
Mef2b G A 8: 70,167,268 D345N probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 C T 7: 64,314,159 T214M possibly damaging Het
Olfr1289 A T 2: 111,483,564 M45L probably benign Het
Olfr309 A G 7: 86,307,152 probably benign Het
Olfr980 A G 9: 40,006,281 S223P probably damaging Het
Orc1 T C 4: 108,602,055 probably null Het
P4htm T C 9: 108,581,996 S246G probably null Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde6b A G 5: 108,403,368 K173E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Plekhh2 A G 17: 84,566,097 D270G probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Ryr1 C A 7: 29,074,580 probably benign Het
Slc4a1ap G A 5: 31,532,029 V347M probably damaging Het
Tln1 C A 4: 43,533,598 A2319S probably damaging Het
Tm6sf1 G A 7: 81,859,461 A5T probably damaging Het
Tnfrsf22 C T 7: 143,649,576 R19Q unknown Het
Tnfsf11 T C 14: 78,278,580 D316G probably damaging Het
Trerf1 G A 17: 47,327,071 noncoding transcript Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Unc79 C T 12: 102,991,461 T45I probably damaging Het
Usp3 G T 9: 66,520,765 probably benign Het
Wdr31 A C 4: 62,453,922 L319W probably damaging Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Tmem117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Tmem117 APN 15 95094664 missense probably benign
IGL02342:Tmem117 APN 15 95011450 missense possibly damaging 0.76
IGL02418:Tmem117 APN 15 94931884 missense probably benign 0.10
IGL02651:Tmem117 APN 15 95094561 missense probably damaging 1.00
IGL02740:Tmem117 APN 15 94714982 missense probably benign 0.00
IGL02819:Tmem117 APN 15 94879372 splice site probably benign
IGL02881:Tmem117 APN 15 94879425 missense probably damaging 1.00
IGL02887:Tmem117 APN 15 95094775 missense probably damaging 1.00
IGL03371:Tmem117 APN 15 95011393 missense probably damaging 1.00
R0464:Tmem117 UTSW 15 94714919 missense probably damaging 0.98
R0539:Tmem117 UTSW 15 94714912 missense possibly damaging 0.63
R1029:Tmem117 UTSW 15 95011336 missense probably benign
R1424:Tmem117 UTSW 15 94931808 missense probably benign 0.35
R1439:Tmem117 UTSW 15 95094597 missense probably benign
R1498:Tmem117 UTSW 15 94638361 missense probably damaging 1.00
R1604:Tmem117 UTSW 15 95094544 missense probably damaging 1.00
R1746:Tmem117 UTSW 15 94931833 missense possibly damaging 0.55
R1829:Tmem117 UTSW 15 95094551 missense probably damaging 1.00
R3434:Tmem117 UTSW 15 95094692 missense probably damaging 0.98
R3435:Tmem117 UTSW 15 95094692 missense probably damaging 0.98
R4560:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4561:Tmem117 UTSW 15 95094796 missense probably benign 0.00
R4563:Tmem117 UTSW 15 94638154 missense possibly damaging 0.95
R4777:Tmem117 UTSW 15 95094450 nonsense probably null
R4854:Tmem117 UTSW 15 95094688 missense probably damaging 0.97
R5051:Tmem117 UTSW 15 94714913 missense probably damaging 0.96
R5472:Tmem117 UTSW 15 95094513 missense possibly damaging 0.91
R5485:Tmem117 UTSW 15 95094830 missense probably benign 0.00
R5488:Tmem117 UTSW 15 95094817 frame shift probably null
R5595:Tmem117 UTSW 15 95094884 missense probably damaging 0.99
R5648:Tmem117 UTSW 15 95094772 missense possibly damaging 0.88
R5892:Tmem117 UTSW 15 94638139 missense probably damaging 0.99
R5901:Tmem117 UTSW 15 94714958 missense probably benign 0.08
R6334:Tmem117 UTSW 15 95011443 missense probably benign 0.01
R7216:Tmem117 UTSW 15 94714912 missense possibly damaging 0.91
R7266:Tmem117 UTSW 15 94931803 missense possibly damaging 0.82
R7414:Tmem117 UTSW 15 94714895 missense probably damaging 1.00
R7445:Tmem117 UTSW 15 94714918 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGTGACATGTTCTTACACAGCAG -3'
(R):5'- TCATCCTTTGAGAGGCTGCC -3'

Sequencing Primer
(F):5'- TCTTACACAGCAGGTTCATAGGG -3'
(R):5'- TGCCGGCTCTTGCTCAG -3'
Posted On2015-09-24