Incidental Mutation 'R4562:Usp3'
ID343151
Institutional Source Beutler Lab
Gene Symbol Usp3
Ensembl Gene ENSMUSG00000032376
Gene Nameubiquitin specific peptidase 3
Synonyms
MMRRC Submission 041787-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R4562 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location66514637-66593142 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 66520765 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098613] [ENSMUST00000127569] [ENSMUST00000139547] [ENSMUST00000174387]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034940
Predicted Effect probably benign
Transcript: ENSMUST00000098613
SMART Domains Protein: ENSMUSP00000096213
Gene: ENSMUSG00000032376

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 6.6e-23 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 188 1.1e-8 PFAM
Pfam:UCH 178 470 4.2e-54 PFAM
Pfam:UCH_1 193 452 3.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127569
SMART Domains Protein: ENSMUSP00000122199
Gene: ENSMUSG00000032376

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 1.2e-22 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 508 2.5e-61 PFAM
Pfam:UCH_1 206 490 2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132255
Predicted Effect probably benign
Transcript: ENSMUST00000139547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150840
Predicted Effect probably benign
Transcript: ENSMUST00000174387
SMART Domains Protein: ENSMUSP00000134472
Gene: ENSMUSG00000032376

DomainStartEndE-ValueType
Pfam:zf-UBP 29 142 1.6e-7 PFAM
Pfam:UCH 114 464 9.9e-69 PFAM
Pfam:UCH_1 115 446 2e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: The protein encoded by this gene is a chromatin-associated histone 2A and 2B deubiquitinating enzyme that negatively regulates the DNA damage response. Mice deficient for this enzyme have reduced hematopoietic stem cell reserves, demonstrating a requirement in hematopoietic stem cell homeostasis. In addition, knock down of protein levels results in spontaneous tumor development and shortened lifespan, consistent with a function in preserving chromosomal integrity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 G A 3: 36,066,182 R25K probably benign Het
Acap1 C T 11: 69,885,351 probably benign Het
Aox1 T C 1: 58,059,056 L309P probably damaging Het
Arhgap8 A C 15: 84,741,913 D63A probably damaging Het
Asap2 A G 12: 21,112,093 D17G probably damaging Het
Atp8b1 A T 18: 64,556,891 V590D probably damaging Het
Bace2 G A 16: 97,421,980 R368Q probably damaging Het
Cad G A 5: 31,058,133 S96N possibly damaging Het
Csmd3 T C 15: 47,899,844 T1303A probably benign Het
Defa24 A G 8: 21,734,507 probably benign Het
Dffb A G 4: 153,965,456 C317R probably damaging Het
Erap1 T C 13: 74,673,659 V711A probably benign Het
Esco1 A G 18: 10,595,074 S71P possibly damaging Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Fam208a A G 14: 27,466,308 T904A possibly damaging Het
Gm10797 A G 10: 67,572,685 noncoding transcript Het
Gm10822 C T 2: 73,899,489 noncoding transcript Het
Gm9268 C T 7: 43,023,562 Q130* probably null Het
Huwe1 A T X: 151,863,959 I682F probably damaging Het
Ift22 A G 5: 136,912,870 E152G probably benign Het
Ighv3-5 T A 12: 114,262,878 T25S possibly damaging Het
Ivl CCTGCTGCTGCT CCTGCTGCTGCTGCT 3: 92,571,955 probably benign Het
Kcna5 T C 6: 126,534,340 H275R probably benign Het
Kdm7a C T 6: 39,152,823 R473Q probably damaging Het
Klf14 G A 6: 30,958,459 A80V probably damaging Het
Lrrc71 T A 3: 87,745,408 probably benign Het
Lypd8 T A 11: 58,382,389 probably null Het
Mef2b G A 8: 70,167,268 D345N probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 C T 7: 64,314,159 T214M possibly damaging Het
Olfr1289 A T 2: 111,483,564 M45L probably benign Het
Olfr309 A G 7: 86,307,152 probably benign Het
Olfr980 A G 9: 40,006,281 S223P probably damaging Het
Orc1 T C 4: 108,602,055 probably null Het
P4htm T C 9: 108,581,996 S246G probably null Het
Pax2 A G 19: 44,835,963 Y374C unknown Het
Pde6b A G 5: 108,403,368 K173E probably benign Het
Pde8a T A 7: 81,308,820 Y315* probably null Het
Plekhh2 A G 17: 84,566,097 D270G probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Ryr1 C A 7: 29,074,580 probably benign Het
Slc4a1ap G A 5: 31,532,029 V347M probably damaging Het
Tln1 C A 4: 43,533,598 A2319S probably damaging Het
Tm6sf1 G A 7: 81,859,461 A5T probably damaging Het
Tmem117 A T 15: 95,094,796 M446L probably benign Het
Tnfrsf22 C T 7: 143,649,576 R19Q unknown Het
Tnfsf11 T C 14: 78,278,580 D316G probably damaging Het
Trerf1 G A 17: 47,327,071 noncoding transcript Het
Ttc13 A G 8: 124,675,277 L657P probably damaging Het
Unc79 C T 12: 102,991,461 T45I probably damaging Het
Wdr31 A C 4: 62,453,922 L319W probably damaging Het
Zfp947 G T 17: 22,146,143 Y183* probably null Het
Other mutations in Usp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Usp3 APN 9 66562552 critical splice donor site probably null
IGL02951:Usp3 APN 9 66542550 nonsense probably null
IGL03283:Usp3 APN 9 66562549 splice site probably null
R0148:Usp3 UTSW 9 66540167 missense possibly damaging 0.80
R0152:Usp3 UTSW 9 66540150 missense probably damaging 0.97
R0184:Usp3 UTSW 9 66562581 missense probably damaging 0.99
R0628:Usp3 UTSW 9 66518444 missense probably benign 0.05
R1036:Usp3 UTSW 9 66530231 splice site probably benign
R2251:Usp3 UTSW 9 66562578 missense probably damaging 0.99
R2437:Usp3 UTSW 9 66545742 critical splice donor site probably null
R3957:Usp3 UTSW 9 66562591 missense probably benign 0.04
R4320:Usp3 UTSW 9 66530248 missense possibly damaging 0.80
R4439:Usp3 UTSW 9 66518494 missense probably benign 0.00
R4659:Usp3 UTSW 9 66527070 intron probably null
R4742:Usp3 UTSW 9 66520677 missense probably damaging 1.00
R5134:Usp3 UTSW 9 66542532 missense possibly damaging 0.82
R5242:Usp3 UTSW 9 66527150 missense probably damaging 1.00
R5556:Usp3 UTSW 9 66544021 missense possibly damaging 0.88
R6949:Usp3 UTSW 9 66520690 missense probably benign 0.37
R7440:Usp3 UTSW 9 66530255 missense probably benign 0.03
R7452:Usp3 UTSW 9 66566898 missense probably benign 0.11
R7547:Usp3 UTSW 9 66542624 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CACATCACTGACCTTGGGAAG -3'
(R):5'- CTGCCTTATCTAGGGAACAAAGGAC -3'

Sequencing Primer
(F):5'- CACTGACCTTGGGAAGTTTTTGAATC -3'
(R):5'- TGGCTGTCCTGGAACTCAC -3'
Posted On2015-09-24