Incidental Mutation 'R4585:Zfp473'
ID344015
Institutional Source Beutler Lab
Gene Symbol Zfp473
Ensembl Gene ENSMUSG00000048012
Gene Namezinc finger protein 473
SynonymsD030014N22Rik
MMRRC Submission 041806-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4585 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44731480-44751050 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 44732952 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 651 (Y651*)
Ref Sequence ENSEMBL: ENSMUSP00000113789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060270] [ENSMUST00000118162] [ENSMUST00000120074] [ENSMUST00000120798] [ENSMUST00000126366] [ENSMUST00000140599] [ENSMUST00000149011]
Predicted Effect probably null
Transcript: ENSMUST00000060270
AA Change: Y652*
SMART Domains Protein: ENSMUSP00000051069
Gene: ENSMUSG00000048012
AA Change: Y652*

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118162
AA Change: Y651*
SMART Domains Protein: ENSMUSP00000113316
Gene: ENSMUSG00000048012
AA Change: Y651*

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120074
AA Change: Y652*
SMART Domains Protein: ENSMUSP00000113774
Gene: ENSMUSG00000048012
AA Change: Y652*

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120798
AA Change: Y651*
SMART Domains Protein: ENSMUSP00000113789
Gene: ENSMUSG00000048012
AA Change: Y651*

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126366
SMART Domains Protein: ENSMUSP00000127101
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140599
SMART Domains Protein: ENSMUSP00000127738
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149011
SMART Domains Protein: ENSMUSP00000130689
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Krueppel C2H2-type zinc-finger family of proteins. The encoded protein, a component of the U7 snRNP complex, plays a role in histone 3'-end pre-mRNA processing and may be required for cell cycle progression to S phase. Expression level and methylation status of this gene may be correlated with bone mineral density. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Akr7a5 G T 4: 139,310,927 R58L probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Aurkaip1 C A 4: 155,832,634 A113D possibly damaging Het
Bsn T C 9: 108,110,463 probably benign Het
Ccdc175 T G 12: 72,175,179 D123A possibly damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Ccnt2 T C 1: 127,803,029 S548P probably damaging Het
Cep126 T C 9: 8,103,337 Q224R probably damaging Het
Cic A T 7: 25,272,778 I645L probably benign Het
Cngb1 C T 8: 95,297,128 probably null Het
Col13a1 T C 10: 61,887,245 probably null Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Crebrf A G 17: 26,762,255 K535R probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cxcr5 T A 9: 44,514,145 I72F probably benign Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dlgap2 G A 8: 14,727,999 probably null Het
Dnah8 A G 17: 30,751,567 D2684G probably benign Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 G A 18: 6,441,157 Q14* probably null Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Glra3 C A 8: 56,088,993 T257K probably damaging Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm19965 T A 1: 116,821,778 N396K probably benign Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gsdmd T A 15: 75,865,751 probably null Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Lctl T C 9: 64,131,600 S324P probably damaging Het
Lrrc24 C A 15: 76,723,689 R43L probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mroh5 T A 15: 73,789,271 T467S probably benign Het
Mtap G A 4: 89,172,274 V194I probably benign Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pabpc6 A G 17: 9,669,073 L183P probably damaging Het
Pcdh15 C T 10: 74,624,284 R1355W probably damaging Het
Pcdhgb8 C A 18: 37,762,360 A161E probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Phc2 A T 4: 128,743,510 H563L probably damaging Het
Plekha2 C A 8: 25,043,669 E291* probably null Het
Qser1 C A 2: 104,786,793 V1225L probably benign Het
Ralgapa2 A T 2: 146,315,024 D1882E probably damaging Het
Rgs17 T C 10: 5,842,596 D70G probably benign Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Scn2a T A 2: 65,743,051 probably null Het
Serpinb10 T A 1: 107,547,049 C314S probably benign Het
Setbp1 A C 18: 79,086,949 S23A probably benign Het
Sh3pxd2b A G 11: 32,396,479 D116G possibly damaging Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx19 T C 9: 30,440,195 L155P probably damaging Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Strn3 T A 12: 51,650,170 E259D probably benign Het
Tenm1 G A X: 42,537,979 Q1931* probably null Het
Trp53bp1 C G 2: 121,207,951 G1469R probably damaging Het
Ttc8 C A 12: 98,982,530 Q492K probably benign Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Utrn T A 10: 12,688,306 H1270L probably benign Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdfy4 T A 14: 33,087,955 I1770F possibly damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Other mutations in Zfp473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp473 APN 7 44734568 missense probably damaging 1.00
IGL01443:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01459:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01905:Zfp473 APN 7 44733727 missense probably benign 0.00
IGL02027:Zfp473 APN 7 44738038 splice site probably benign
IGL02314:Zfp473 APN 7 44733929 missense probably benign 0.00
IGL02445:Zfp473 APN 7 44733683 missense probably damaging 1.00
IGL03033:Zfp473 APN 7 44733098 missense probably benign 0.05
R0037:Zfp473 UTSW 7 44733900 missense probably damaging 0.96
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0190:Zfp473 UTSW 7 44733188 missense probably damaging 1.00
R1178:Zfp473 UTSW 7 44734594 missense probably benign 0.00
R1387:Zfp473 UTSW 7 44732941 missense probably benign 0.00
R2141:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R2142:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R4194:Zfp473 UTSW 7 44732252 missense probably benign 0.08
R4453:Zfp473 UTSW 7 44733254 missense probably damaging 0.99
R4586:Zfp473 UTSW 7 44732952 nonsense probably null
R4945:Zfp473 UTSW 7 44734564 missense probably benign 0.00
R5072:Zfp473 UTSW 7 44732519 missense probably damaging 0.98
R5429:Zfp473 UTSW 7 44732848 missense possibly damaging 0.69
R5464:Zfp473 UTSW 7 44732638 missense probably damaging 1.00
R5551:Zfp473 UTSW 7 44734151 missense probably benign 0.03
R5618:Zfp473 UTSW 7 44741732 missense probably benign 0.08
R5985:Zfp473 UTSW 7 44733328 missense probably damaging 1.00
R6288:Zfp473 UTSW 7 44733534 missense probably damaging 1.00
R6701:Zfp473 UTSW 7 44732794 missense possibly damaging 0.58
R7069:Zfp473 UTSW 7 44732374 missense probably damaging 1.00
R7284:Zfp473 UTSW 7 44733203 missense not run
R7361:Zfp473 UTSW 7 44733139 missense probably damaging 1.00
R7495:Zfp473 UTSW 7 44737944 missense probably benign 0.04
R7631:Zfp473 UTSW 7 44733704 missense possibly damaging 0.62
X0027:Zfp473 UTSW 7 44733418 missense probably damaging 1.00
Z1177:Zfp473 UTSW 7 44732308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGAAAGGTGGGCACGC -3'
(R):5'- ACACTTCATTTGCAGGTCAAC -3'

Sequencing Primer
(F):5'- ACGCTGTTTGAAGGCCCTG -3'
(R):5'- GCAGGTCAACTCTGAATTGC -3'
Posted On2015-09-24