Incidental Mutation 'R4650:Edc4'
ID351224
Institutional Source Beutler Lab
Gene Symbol Edc4
Ensembl Gene ENSMUSG00000036270
Gene Nameenhancer of mRNA decapping 4
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4650 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105880881-105894908 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 105892675 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1293 (L1293*)
Ref Sequence ENSEMBL: ENSMUSP00000114285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040254] [ENSMUST00000060167] [ENSMUST00000118920] [ENSMUST00000119261] [ENSMUST00000136048] [ENSMUST00000145618]
Predicted Effect probably null
Transcript: ENSMUST00000040254
AA Change: L1345*
SMART Domains Protein: ENSMUSP00000039134
Gene: ENSMUSG00000036270
AA Change: L1345*

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
coiled coil region 1001 1030 N/A INTRINSIC
low complexity region 1267 1285 N/A INTRINSIC
PDB:2VXG|B 1286 1402 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000060167
SMART Domains Protein: ENSMUSP00000056940
Gene: ENSMUSG00000044287

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:NRN1 39 118 2.1e-28 PFAM
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118920
SMART Domains Protein: ENSMUSP00000113445
Gene: ENSMUSG00000044287

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:NRN1 38 120 3.4e-27 PFAM
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119261
AA Change: L1329*
SMART Domains Protein: ENSMUSP00000113854
Gene: ENSMUSG00000036270
AA Change: L1329*

DomainStartEndE-ValueType
Blast:WD40 33 93 1e-7 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
WD40 333 384 2.3e0 SMART
low complexity region 609 644 N/A INTRINSIC
low complexity region 664 692 N/A INTRINSIC
low complexity region 773 785 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
coiled coil region 985 1014 N/A INTRINSIC
low complexity region 1251 1269 N/A INTRINSIC
PDB:2VXG|B 1270 1386 3e-18 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000132680
SMART Domains Protein: ENSMUSP00000114209
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
low complexity region 189 224 N/A INTRINSIC
low complexity region 245 273 N/A INTRINSIC
low complexity region 354 366 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000136048
AA Change: L1293*
SMART Domains Protein: ENSMUSP00000114285
Gene: ENSMUSG00000036270
AA Change: L1293*

DomainStartEndE-ValueType
Blast:WD40 33 93 9e-8 BLAST
low complexity region 103 110 N/A INTRINSIC
WD40 165 205 1.99e0 SMART
low complexity region 243 253 N/A INTRINSIC
WD40 286 325 1.38e-2 SMART
low complexity region 549 584 N/A INTRINSIC
low complexity region 604 632 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
low complexity region 961 990 N/A INTRINSIC
low complexity region 1215 1233 N/A INTRINSIC
PDB:2VXG|B 1234 1317 1e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139154
Predicted Effect probably benign
Transcript: ENSMUST00000145618
SMART Domains Protein: ENSMUSP00000118162
Gene: ENSMUSG00000036270

DomainStartEndE-ValueType
low complexity region 185 220 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156357
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is thought to promote mRNA decay, and is known to interact with several mRNA decapping proteins. In humans, decreased expression of this gene prevents the accumulation of mRNA decapping proteins to mRNA processing bodies (P-body). Alternative splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T A 16: 89,063,715 Y77F unknown Het
4933409G03Rik G A 2: 68,606,215 E168K unknown Het
Aldoa A G 7: 126,797,707 S71P possibly damaging Het
Arhgef12 A G 9: 42,981,970 V979A probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Brd8 T C 18: 34,606,699 T674A probably benign Het
Cacna1d C T 14: 30,095,408 M1232I probably benign Het
Capza1 A G 3: 104,844,980 V14A probably damaging Het
Cdk2 A T 10: 128,702,495 I135N probably damaging Het
Celf4 A T 18: 25,496,245 M407K possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Cideb A G 14: 55,755,231 V76A possibly damaging Het
Dbpht2 C G 12: 74,299,159 noncoding transcript Het
Dis3l2 A G 1: 86,990,321 D550G possibly damaging Het
Dnah1 A T 14: 31,284,887 probably null Het
Elp5 A G 11: 69,969,572 V203A possibly damaging Het
Fndc7 T C 3: 108,862,819 N597S probably benign Het
Gjb3 T C 4: 127,326,691 Y16C probably damaging Het
Gm5773 A G 3: 93,773,405 D128G probably benign Het
Gnb1l T C 16: 18,544,275 probably null Het
Gon4l G A 3: 88,863,552 D514N possibly damaging Het
Grhl3 T A 4: 135,549,236 probably null Het
Hoxc10 T C 15: 102,967,263 S136P probably benign Het
Ift22 G A 5: 136,911,801 V107I probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lamc1 T G 1: 153,228,777 S59R probably damaging Het
Lgi4 G A 7: 31,069,129 A518T probably benign Het
Lhx2 T A 2: 38,360,040 N290K probably damaging Het
Ltbp4 A T 7: 27,314,309 C1092S probably damaging Het
Macf1 T C 4: 123,473,619 I2450V probably benign Het
Mefv A G 16: 3,717,818 L82P probably damaging Het
Myb A G 10: 21,152,941 L86P probably damaging Het
Myh3 C T 11: 67,086,444 T333M probably damaging Het
Nek11 T C 9: 105,348,080 N78D possibly damaging Het
Nmi C A 2: 51,948,634 C296F probably benign Het
Nphs1 A T 7: 30,482,470 T1163S probably benign Het
Npy4r C T 14: 34,146,224 G369D possibly damaging Het
Ola1 T C 2: 73,141,965 T221A probably damaging Het
Olfr251 T C 9: 38,378,403 F168S probably damaging Het
Olfr557 A G 7: 102,698,820 D194G probably damaging Het
Pfkfb2 A T 1: 130,705,463 N184K possibly damaging Het
Plce1 T C 19: 38,524,644 V129A probably benign Het
Prps2 T C X: 167,352,292 D183G probably damaging Het
Pth A T 7: 113,385,819 *116K probably null Het
R3hdm1 T C 1: 128,184,444 S422P probably damaging Het
Rhox2a G C X: 37,245,309 R43P probably benign Het
Rwdd3 A G 3: 121,159,177 F55S probably damaging Het
Serpinb9d A T 13: 33,202,853 L301F probably benign Het
Slc35e4 A G 11: 3,912,677 C171R probably damaging Het
Slco1a4 A T 6: 141,812,698 I529K possibly damaging Het
Styk1 A T 6: 131,300,569 W370R probably damaging Het
Tmprss11e C A 5: 86,727,353 W18L probably damaging Het
Trpv1 A C 11: 73,238,263 E2A probably benign Het
Unc13b T A 4: 43,261,035 I1799N probably damaging Het
Vmn1r213 G A 13: 23,012,252 C335Y possibly damaging Het
Vps37c C T 19: 10,712,909 S245L probably benign Het
Wrn T C 8: 33,255,509 T1191A probably benign Het
Zfp13 A G 17: 23,580,138 L153P probably damaging Het
Zfp472 T G 17: 32,977,657 S235R possibly damaging Het
Other mutations in Edc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Edc4 APN 8 105881123 missense probably damaging 1.00
IGL01069:Edc4 APN 8 105887134 missense probably benign 0.35
IGL01470:Edc4 APN 8 105889981 unclassified probably benign
IGL01656:Edc4 APN 8 105886377 missense possibly damaging 0.55
IGL01804:Edc4 APN 8 105890657 missense possibly damaging 0.92
IGL02135:Edc4 APN 8 105885822 missense probably damaging 1.00
IGL02825:Edc4 APN 8 105890611 missense probably damaging 1.00
IGL03036:Edc4 APN 8 105887311 unclassified probably null
IGL03401:Edc4 APN 8 105887514 nonsense probably null
IGL03409:Edc4 APN 8 105885116 missense probably damaging 1.00
Armor UTSW 8 105890867 missense probably damaging 1.00
mail UTSW 8 105886309 splice site probably null
R0362:Edc4 UTSW 8 105886775 missense probably damaging 1.00
R0541:Edc4 UTSW 8 105889428 missense probably benign 0.00
R0614:Edc4 UTSW 8 105889396 missense possibly damaging 0.93
R0631:Edc4 UTSW 8 105890792 missense possibly damaging 0.57
R1067:Edc4 UTSW 8 105891005 missense probably damaging 0.97
R1270:Edc4 UTSW 8 105891264 missense possibly damaging 0.90
R1371:Edc4 UTSW 8 105890750 unclassified probably benign
R1384:Edc4 UTSW 8 105892382 missense probably damaging 1.00
R1417:Edc4 UTSW 8 105887855 critical splice donor site probably null
R1423:Edc4 UTSW 8 105891211 unclassified probably benign
R1446:Edc4 UTSW 8 105888132 missense probably damaging 0.96
R1472:Edc4 UTSW 8 105892828 missense probably damaging 0.99
R1797:Edc4 UTSW 8 105891085 missense probably benign 0.03
R2086:Edc4 UTSW 8 105888002 missense probably damaging 1.00
R2092:Edc4 UTSW 8 105887528 missense probably damaging 1.00
R3079:Edc4 UTSW 8 105885118 missense possibly damaging 0.86
R3551:Edc4 UTSW 8 105885494 missense probably damaging 1.00
R4492:Edc4 UTSW 8 105885068 frame shift probably null
R4735:Edc4 UTSW 8 105887186 missense probably damaging 1.00
R4854:Edc4 UTSW 8 105887925 intron probably benign
R5530:Edc4 UTSW 8 105889254 nonsense probably null
R5851:Edc4 UTSW 8 105890867 missense probably damaging 1.00
R5889:Edc4 UTSW 8 105888022 missense possibly damaging 0.87
R5903:Edc4 UTSW 8 105890587 missense probably benign 0.04
R5996:Edc4 UTSW 8 105887401 missense probably damaging 1.00
R6078:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6079:Edc4 UTSW 8 105887548 missense probably benign 0.01
R6143:Edc4 UTSW 8 105885874 missense probably damaging 1.00
R7072:Edc4 UTSW 8 105888002 missense probably damaging 1.00
R7211:Edc4 UTSW 8 105886309 splice site probably null
R7368:Edc4 UTSW 8 105888405 small deletion probably benign
R7429:Edc4 UTSW 8 105891584 missense probably damaging 1.00
R7430:Edc4 UTSW 8 105891584 missense probably damaging 1.00
R7787:Edc4 UTSW 8 105887514 nonsense probably null
RF009:Edc4 UTSW 8 105889180 missense probably benign 0.27
RF014:Edc4 UTSW 8 105884600 missense probably benign
U15987:Edc4 UTSW 8 105887548 missense probably benign 0.01
X0018:Edc4 UTSW 8 105887001 missense probably damaging 1.00
X0063:Edc4 UTSW 8 105884580 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TAGCAGACACCCACTCTTGC -3'
(R):5'- TGACCTAAACCTGCCAACTG -3'

Sequencing Primer
(F):5'- GACACCCACTCTTGCCTGAC -3'
(R):5'- CCCTCTTTAAATGGCTAAGGGAG -3'
Posted On2015-10-08